Divalent metal activation of a GH43 β-xylosidase.

No abstract is available for this paper.

• Publication year

  2013

• Venue

  Enzyme and Microbial Technology

• Publication date

  2013-02-05

• Fields of study

  Biology, Medicine, Chemistry, Environmental Science

• Identifiers
  DOI 10.1016/j.enzmictec.2012.10.010PMID 23273276
• External record

  Open on Semantic Scholar

• Source metadata

  Semantic Scholar, PubMed

• No claims are published for this paper.

• No concepts are published for this paper.

• Isolation of α-Glucuronidase Enzyme from a Rumen Metagenomic Library

  2012cited by this paper
• Catalytic properties of β-d-xylosidase XylBH43 from Bacillus halodurans C-125 and mutant XylBH43-W147G

  2012cited by this paper
• Functional Association of Catalytic and Ancillary Modules Dictates Enzymatic Activity in Glycoside Hydrolase Family 43 β-Xylosidase*

  2012cited by this paper
• Plant cell walls to ethanol.

  2012cited by this paper
• Cloning and Characterization of Two β-Glucosidase/Xylosidase Enzymes from Yak Rumen Metagenome

  2011cited by this paper
• Opposing influences by subsite -1 and subsite +1 residues on relative xylopyranosidase/arabinofuranosidase activities of bifunctional β-D-xylosidase/α-L-arabinofuranosidase.

  2011cited by this paper
• Biochemical and kinetic characterization of GH43 β-d-xylosidase/α-l-arabinofuranosidase and GH30 α-l-arabinofuranosidase/β-d-xylosidase from rumen metagenome

  2011cited by this paper
• New evidence for the role of calcium in the glycosidase reaction of GH43 arabinanases

  2010cited by this paper
• Engineering lower inhibitor affinities in β-d-xylosidase

  2010cited by this paper
• Isolation and basic characterization of a β‐glucosidase from a strain of Lactobacillus brevis isolated from a malolactic starter culture

  2010cited by this paper
• Properties and applications of microbial β-D-xylosidases featuring the catalytically efficient enzyme from Selenomonas ruminantium

  2010cited by this paper
• Domain Analysis of a Modular α-l-Arabinofuranosidase with a Unique Carbohydrate Binding Strategy from the Fiber-Degrading Bacterium Fibrobacter succinogenes S85

  2010cited by this paper
• Catalytic properties of the immobilized Talaromyces thermophilus β-xylosidase and its use for xylose and xylooligosaccharides production

  2009cited by this paper
• An α-Glucuronidase Enzyme Activity Assay Adaptable for Solid Phase Screening

  2009cited by this paper
• Biochemical characterization of a novel dual-function arabinofuranosidase/xylosidase isolated from a compost starter mixture

  2009cited by this paper
• The Carbohydrate-Active EnZymes database (CAZy): an expert resource for Glycogenomics

  2008cited by this paper
• Β-d-Xylosidase from Selenomonas ruminantium: Catalyzed Reactions with Natural and Artificial Substrates

  2008cited by this paper
• Structure of the two-subsite beta-d-xylosidase from Selenomonas ruminantium in complex with 1,3-bis[tris(hydroxymethyl)methylamino]propane.

  2008cited by this paper
• Gene cloning and expression in Escherichia coli of a bi-functional beta-D-xylosidase/alpha-L-arabinosidase from Sulfolobus solfataricus involved in xylan degradation.

  2007cited by this paper
• Variation in relative substrate specificity of bifunctional β-D -xylosidase/α -L -arabinofuranosidase by single-site mutations : Roles of substrate distortion and recognition

  2007cited by this paper
• Inhibition of the two-subsite beta-d-xylosidase from Selenomonas ruminantium by sugars: competitive, noncompetitive, double binding, and slow binding modes.

  2007cited by this paper
• Variation in relative substrate specificity of bifunctional beta-D-xylosidase/alpha-L-arabinofuranosidase by single-site mutations: roles of substrate distortion and recognition.

  2007cited by this paper
• Gene cloning and expression in Escherichia coli of a bi-functional β-d-xylosidase/α-l-arabinosidase from Sulfolobus solfataricus involved in xylan degradation

  2006cited by this paper
• Tailored catalysts for plant cell-wall degradation: redesigning the exo/endo preference of Cellvibrio japonicus arabinanase 43A.

  2005cited by this paper
• Biochemical characterization and identification of the catalytic residues of a family 43 beta-D-xylosidase from Geobacillus stearothermophilus T-6.

  2005cited by this paper
• Purification and characterization of β-xylosidase from Streptomycessp. CH7 and its gene sequence analysis

  2004cited by this paper
• Purification and characterization of thermostable xylanase and beta-xylosidase by the thermophilic bacterium Bacillus thermantarcticus.

  2004cited by this paper
• Cloning, Sequencing, and Expression of the Gene Encoding an Intracellular β-D-Xylosidase from Streptomyces thermoviolaceus OPC-520

  2001cited by this paper
• Cloning, sequencing, and characterization of the bifunctional xylosidase-arabinosidase from the anaerobic thermophile thermoanaerobacter ethanolicus.

  2000cited by this paper
• Updating the sequence-based classification of glycosyl hydrolases.

  1996cited by this paper
• Purification and biochemical characterization of β-xylosidase from Humicola grisea var. thermoidea

  1995cited by this paper
• Zinc inhibition of renin and the protease from human immunodeficiency virus type 1.

  1991cited by this paper
• Purification and characterization of β-xylosidase from Aureobasidium pullulans

  1991cited by this paper
• Purification and characterization of an extracellular beta-xylosidase from the rumen anaerobic fungus Neocallimastix frontalis.

  1990cited by this paper
• Purification and characterization of a thermostable β-xylosidase from Thermomonospora fusca

  1989cited by this paper
• Isolation and characterization of β-xylosidase from a recombinant Escherichia coli strain

  1987cited by this paper
• Purification and Properties of Endo-1,4-β-Xylanase from Humicola lanuginosa

  1984cited by this paper
• Kinetic study of the activation process of -galactosidase from Escherichia coli by Mg 2+ .

  1972cited by this paper

• Heterologous expression and characterization of xylose-tolerant GH 43 family β-xylosidase/α-L-arabinofuranosidase from Limosilactobacillus fermentum and its application in xylan degradation

  2025cites this paper
• Ultrahigh-Throughput Screening of High-β-Xylosidase-Producing Penicillium piceum and Investigation of the Novel β-Xylosidase Characteristics

  2022cites this paper
• Two distinct catalytic pathways for GH43 xylanolytic enzymes unveiled by X-ray and QM/MM simulations

  2021cites this paper
• Contributions and characteristics of two bifunctional GH43 β-xylosidase /α-L-arabinofuranosidases with different structures on the xylan degradation of Paenibacillus physcomitrellae strain XB.

  2021cites this paper
• Characterization and Phylogenetic Analysis of a Novel GH43 β-Xylosidase From Neocallimastix californiae

  2021cites this paper
• Two Bifunctional β-Xylosidase /α-L-Arabinofuranosidases From GH43 With Different Structures in the xylan Degradation Strain of Paenibacillus Physcomitrellae XB Displayed the Similar xylo-oligosaccharides Degradation Ability

  2021cites this paper
• Characterization of a recombinant β-xylosidase of GH43 family from Bacteroides ovatus strain ATCC 8483

  2020cites this paper
• Novel xylan-degrading enzymes from polysaccharide utilizing loci of Prevotella copri DSM18205

  2020cites this paper
• β-Xylosidases: Structural Diversity, Catalytic Mechanism, and Inhibition by Monosaccharides

  2019influential citation
• The modular arabinanolytic enzyme Abf43A-Abf43B-Abf43C from Ruminiclostridium josui consists of three GH43 modules classified in different subfamilies.

  2019cites this paper
• EcXyl43 β-xylosidase: molecular modeling, activity on natural and artificial substrates, and synergism with endoxylanases for lignocellulose deconstruction

  2018cites this paper
• Structural, mechanistic and functional characterization of glycoside hydrolases of family GH99

  2018cites this paper
• Production and Characteristics of a Novel Xylose- and Alkali-tolerant GH 43 β-xylosidase from Penicillium oxalicum for Promoting Hemicellulose Degradation

  2017cites this paper
• Characterization of the arabinoxylan-degrading machinery of the thermophilic bacterium Herbinix hemicellulosilytica-Six new xylanases, three arabinofuranosidases and one xylosidase.

  2017cites this paper
• Identification and characterization of the first β-1,3-d-xylosidase from a gram-positive bacterium, Streptomyces sp. SWU10.

  2017cites this paper
• Biochemical Characterization of a GH43 β-Xylosidase from Bacteroides ovatus

  2017cites this paper
• Crystal structure of metagenomic &bgr;-xylosidase/ &agr;-L-arabinofuranosidase activated by calcium

  2017cites this paper
• Effect of Metal Ions, Chemical Agents and Organic Compounds on Lignocellulolytic Enzymes Activities

  2017cites this paper
• Structural dissection of a complex Bacteroides ovatus gene locus conferring xyloglucan metabolism in the human gut

  2016cites this paper
• Genetic and biochemical characterization of hemicellulose polysaccharides utilization in Bacillus subtilis

  2016cites this paper
• Isolation and divalent-metal activation of a β-xylosidase, RUM630-BX.

  2016cites this paper
• ATGAAAACCGAAAAACGTTACCTGGTTCCGGGTGACTACA TGGCTGACCCGGCTGTTCACGTTTTCGACGGTAAACTGTACATCT ACCCGTCTCACGACTGGGAATCTGGTATCGCTGAAAACGACAACG GTGACCACTTCAACATGAAAGACTACCACGTTTACTCTATGGACG ACGTTATGAACGGTGAAATCAAAGACCACGGTGTTGTTCTGTCTA CCGAAGACATCCCGTGGGCTGGTCGTCAGCTGTGGGACTGCGACG TTGTCTGCAAAGACGGGAAATACTACATG

  2016cites this paper
• Biorefinery Developments for Advanced Biofuels from a Sustainable Array of Biomass Feedstocks: Survey of Recent Biomass Conversion Research from Agricultural Research Service

  2016cites this paper
• Screening, identification, and characterization of a GH43 family β-xylosidase/α-arabinofuranosidase from a compost microbial metagenome

  2015cites this paper
• X-ray Crystal Structure of Divalent Metal-Activated β-xylosidase, RS223BX

  2015cites this paper
• Carbohydrate-active enzymes identified by metagenomic analysis of deep-sea sediment bacteria

  2014cites this paper
• Functional and structural diversity in GH62 α-L-arabinofuranosidases from the thermophilic fungus Scytalidium thermophilum

  2014cites this paper
• The importance of the Abn2 calcium cluster in the endo-1,5-arabinanase activity from Bacillus subtilis

  2014cites this paper
• Activation of a GH43 β-xylosidase by divalent metal cations: slow binding of divalent metal and high substrate specificity.

  2013cites this paper
• A Novel α-L-Arabinofuranosidase of Family 43 Glycoside Hydrolase (Ct43Araf) from Clostridium thermocellum

  2013cites this paper
• Rehabilitation of faulty kinetic determinations and misassigned glycoside hydrolase family of retaining mechanism β-xylosidases.

  2013cites this paper
• Arabinoxylan Oligosaccharide Hydrolysis by Family 43 and 51 Glycosidases from Lactobacillus brevis DSM 20054

  2013cites this paper