K7del is a common TPM2 gene mutation associated with nemaline myopathy and raised myofibre calcium sensitivity.

No abstract is available for this paper.

• Publication year

  2013

• Venue

  Brain : a journal of neurology

• Publication date

  2013-02-01

• Fields of study

  Biology, Medicine

• Identifiers
  DOI 10.1093/brain/aws348PMID 23378224
• External record

  Open on Semantic Scholar

• Source metadata

  Semantic Scholar, PubMed

• No claims are published for this paper.

• No concepts are published for this paper.

• Myopathies associated with β-tropomyosin mutations.

  2012influential reference
• Congenital myopathy-causing tropomyosin mutations induce thin filament dysfunction via distinct physiological mechanisms.

  2012cited by this paper
• Nemaline myopathy with stiffness and hypertonia associated with an ACTA1 mutation

  2012cited by this paper
• Abnormal actin binding of aberrant β-tropomyosins is a molecular cause of muscle weakness in TPM2-related nemaline and cap myopathy.

  2012cited by this paper
• Nemaline myopathy with stiffness and hypertonia associated with an ACTA1 mutation

  2012cited by this paper
• Changes in cross-bridge cycling underlie muscle weakness in patients with tropomyosin 3-based myopathy.

  2011cited by this paper
• Tropomyosin position on F-actin revealed by EM reconstruction and computational chemistry.

  2011cited by this paper
• Structure of the tropomyosin overlap complex from chicken smooth muscle: insight into the diversity of N-terminal recognition.

  2010cited by this paper
• Fighting disease by selective autophagy of aggregate‐prone proteins

  2010cited by this paper
• Altered myofilament function depresses force generation in patients with nebulin-based nemaline myopathy (NEM2).

  2010cited by this paper
• Ca2+ sensitizers: An emerging class of agents for counterbalancing weakness in skeletal muscle diseases?

  2010cited by this paper
• Cap disease due to mutation of the beta-tropomyosin gene (TPM2).

  2009cited by this paper
• Thin filament length dysregulation contributes to muscle weakness in nemaline myopathy patients with nebulin deficiency.

  2009cited by this paper
• Absence of beta-tropomyosin is a new cause of Escobar syndrome associated with nemaline myopathy.

  2009cited by this paper
• Defective regulation of contractile function in muscle fibres carrying an E41K β‐tropomyosin mutation

  2008cited by this paper
• Small-angle X-ray scattering reveals the N-terminal domain organization of cardiac myosin binding protein C.

  2008cited by this paper
• The involvement of the ubiquitin proteasome system in human skeletal muscle remodelling and atrophy.

  2008cited by this paper
• Calpain 3, the "gatekeeper" of proper sarcomere assembly, turnover and maintenance.

  2008cited by this paper
• Intermittent inotrope infusion for end stage heart failure in Duchenne muscular dystrophy.

  2008cited by this paper
• Tropomyosin: function follows structure.

  2008cited by this paper
• TPM2 mutation.

  2008cited by this paper
• The Effect of Mutations in α-Tropomyosin (E40K and E54K) That Cause Familial Dilated Cardiomyopathy on the Regulatory Mechanism of Cardiac Muscle Thin Filaments*

  2007cited by this paper
• Effects of a R133W β‐tropomyosin mutation on regulation of muscle contraction in single human muscle fibres

  2007cited by this paper
• Mutations in fast skeletal troponin I, troponin T, and β‐tropomyosin that cause distal arthrogryposis all increase contractile function

  2007cited by this paper
• Intranuclear rod myopathy: molecular pathogenesis and mechanisms of weakness

  2007cited by this paper
• Distal arthrogryposis and muscle weakness associated with a β-tropomyosin mutation

  2007cited by this paper
• Cap disease caused by heterozygous deletion of the beta-tropomyosin gene TPM2.

  2007influential reference
• Solution NMR structure of the junction between tropomyosin molecules: implications for actin binding and regulation.

  2006cited by this paper
• Recurrent de novo mutations of SCN1A in severe myoclonic epilepsy of infancy.

  2006cited by this paper
• Mechanisms and Use of Calcium-Sensitizing Agents in the Failing Heart

  2006cited by this paper
• An alphaTropomyosin mutation alters dimer preference in nemaline myopathy.

  2005cited by this paper
• Tissue-specific Tropomyosin Isoform Composition

  2005cited by this paper
• An αtropomyosin mutation alters dimer preference in nemaline myopathy

  2005cited by this paper
• Evidence for a dominant-negative effect in ACTA1 nemaline myopathy caused by abnormal folding, aggregation and altered polymerization of mutant actin isoforms.

  2004cited by this paper
• UCSF Chimera—A visualization system for exploratory research and analysis

  2004cited by this paper
• Vertebrate tropomyosin: distribution, properties and function

  2004cited by this paper
• Single section Western blot

  2003cited by this paper
• Expression profiling reveals altered satellite cell numbers and glycolytic enzyme transcription in nemaline myopathy muscle

  2003cited by this paper
• Mutations in genes encoding fast-twitch contractile proteins cause distal arthrogryposis syndromes.

  2003cited by this paper
• Expression and biological activity of Baculovirus generated wild-type human slow alpha tropomyosin and the Met9Arg mutant responsible for a dominant form of nemaline myopathy.

  2002cited by this paper
• The crystal structure of the C-terminal fragment of striated-muscle α-tropomyosin reveals a key troponin T recognition site

  2002cited by this paper
• Mutations in the β-tropomyosin (TPM2) gene – a rare cause of nemaline myopathy

  2002cited by this paper
• Mutations in the beta-tropomyosin (TPM2) gene--a rare cause of nemaline myopathy.

  2002cited by this paper
• Tropomyosin 3 increases striated muscle isoform diversity.

  2000cited by this paper
• Estimation of protein secondary structure from circular dichroism spectra: comparison of CONTIN, SELCON, and CDSSTR methods with an expanded reference set.

  2000cited by this paper
• Crystal structure of tropomyosin at 7 Ångstroms resolution

  2000cited by this paper
• Troponin I and troponin T interact with troponin C to produce different Ca2+-dependent effects on actin-tropomyosin filament motility.

  1997cited by this paper
• Replicative Potential and Telomere Length in Human Skeletal Muscle: Implications for Satellite Cell-Mediated Gene Therapy

  1997cited by this paper
• In Vitro Motility Analysis of Actin-Tropomyosin Regulation by Troponin and Calcium

  1995cited by this paper
• Functional alpha-tropomyosin produced in Escherichia coli. A dipeptide extension can substitute the amino-terminal acetyl group.

  1994cited by this paper
• Non-polymerizable tropomyosin: preparation, some properties and F-actin binding.

  1981cited by this paper
• Structural interpretation of the two-site binding of troponin on the muscle thin filament.

  1981cited by this paper
• A comparative study of skeletal and cardiac tropomyosins

  1976cited by this paper

• Transcriptome-wide isoform and promoter remodeling in DM1 fibroblasts uncovered by long-read RNA sequencing.

  2025cites this paper
• Collagenase treatment does not impair fiber contractile function in muscle biopsies from children with cerebral palsy

  2025cites this paper
• Pathogenic TNNI1 variants disrupt sarcomere contractility resulting in hypo- and hypercontractile muscle disease

  2024cites this paper
• Congenital myopathies: pathophysiological mechanisms and promising therapies

  2024cites this paper
• Myotube Guidance: Shaping up the Musculoskeletal System

  2024cites this paper
• Long-read proteogenomics to connect disease-associated sQTLs to the protein isoform effectors of disease.

  2024cites this paper
• Dominantly inherited muscle disorders: understanding their complexity and exploring therapeutic approaches

  2024influential citation
• Small molecule drugs to improve sarcomere function in those with acquired and inherited myopathies.

  2023cites this paper
• Long-read proteogenomics to connect disease-associated sQTLs to the protein isoform effectors of disease

  2023cites this paper
• Variants in tropomyosins TPM2 and TPM3 causing muscle hypertonia.

  2023cites this paper
• A Novel Variant in TPM3 Causing Muscle Weakness and Concomitant Hypercontractile Phenotype

  2023cites this paper
• Clinical and functional characterization of a long survivor congenital titinopathy patient with a novel metatranscript-only titin variant

  2023cites this paper
• Case report: Exome sequencing revealed disease-causing variants in a patient with spondylospinal thoracic dysostosis

  2023cites this paper
• Muscle magnetic resonance imaging involvement patterns in nemaline myopathies

  2023cites this paper
• Metabolic Acidosis Results in Sexually Dimorphic Response in the Heart Tissue

  2023cites this paper
• Early clinical and pre-clinical therapy development in Nemaline myopathy

  2022cites this paper
• Combining Gene Mutation with Expression of Candidate Genes to Improve Diagnosis of Escobar Syndrome

  2022cites this paper
• Nemaline Myopathy in Brazilian Patients: Molecular and Clinical Characterization

  2022influential citation
• A pathogenic mechanism associated with myopathies and structural birth defects involves TPM2-directed myogenesis

  2022cites this paper
• Congenital Nemaline Myopathy with Dense Protein Masses.

  2022cites this paper
• Abnormal TPM2 expression is involved in regulation of atherosclerosis progression via mediating RhoA signaling in vitro

  2021cites this paper
• An in vivo approach to characterize novel variants associated with musculoskeletal disorders

  2021cites this paper
• Update on Congenital Myopathies in Adulthood

  2020cites this paper
• Ovine congenital progressive muscular dystrophy (OCPMD) is a model of TNNT1 congenital myopathy

  2020cites this paper
• Signs and Symptoms in Congenital Myopathies.

  2019cites this paper
• Isolation and Differentiation of Primary Myoblasts from Mouse Skeletal Muscle Explants.

  2019cites this paper
• Dysfunctional sarcomere contractility contributes to muscle weakness in ACTA1‐related nemaline myopathy (NEM3)

  2018cites this paper
• The genetics of congenital myopathies.

  2018cites this paper
• Nemaline myopathy: pathophysiology and therapeutic targets

  2017cites this paper
• Sarcomere Dysfunction in Nemaline Myopathy

  2017cites this paper
• Perm1 enhances mitochondrial biogenesis, oxidative capacity, and fatigue resistance in adult skeletal muscle

  2016cites this paper
• Myopathy-causing Q147P TPM2 mutation shifts tropomyosin strands further towards the open position and increases the proportion of strong-binding cross-bridges during the ATPase cycle.

  2016cites this paper
• Amino Acid Changes at Arginine 204 of Troponin I Result in Increased Calcium Sensitivity of Force Development

  2016cites this paper
• Preparing monodisperse macromolecular samples for successful biological small-angle X-ray and neutron-scattering experiments

  2016cites this paper
• Why Is there a Limit to the Changes in Myofilament Ca2+-Sensitivity Associated with Myopathy Causing Mutations?

  2016cites this paper
• Biochemical Comparison of Tpm1.1 (α) and Tpm2.2 (β) Tropomyosins from Rabbit Skeletal Muscle.

  2016cites this paper
• Mutation‐specific effects on thin filament length in thin filament myopathy

  2016cites this paper
• Clinical utility gene card for: Nemaline myopathy – update 2015

  2015cites this paper
• Muscle weakness in TPM 3-myopathy is due to reduced Ca 2 +-sensitivity and impaired acto-myosin cross-bridge cycling in slow fi bres

  2015cites this paper
• For Peer Review Muscle weakness in TPM3 -myopathy is due to reduced Ca 2+ - sensitivity and impaired acto-myosin cross-bridge cycling in slow fibres

  2015cites this paper
• Congenital and Other Structural Myopathies

  2015cites this paper
• Muscle weakness in TPM3-myopathy is due to reduced Ca2+-sensitivity and impaired acto-myosin cross-bridge cycling in slow fibres.

  2015cites this paper
• 1 ( MHCIIx ) TCTGCAGACGGAGTCAGGT TTGAGTGAATGCCTGTTTGC Myh 2 ( MHCIIa ) GTCAAAGGAGGAGGAACAGCAGC GTTGAGTGAATGCTTGCTTCCCC Myh 4 ( MHCIIb ) TGGCCGAGCAAGAGCTAC TTGATGAGGCTGGTGTTCTG Myh 7 ( MHCI ) GCCAACTATGCTGGAGCTGATGCCC GGTGCGTGGAGCGCAAGTTTGTCATAAG Gapdh TCAACGGGAAGCCCATCA CTCGTGGTTCACACCCATCA PERM 1 D

  2015cites this paper
• Pathophysiological concepts in the congenital myopathies: blurring the boundaries, sharpening the focus.

  2015influential citation
• TPM3 deletions cause a hypercontractile congenital muscle stiffness phenotype

  2015cites this paper
• Mutation Update and Genotype–Phenotype Correlations of Novel and Previously Described Mutations in TPM2 and TPM3 Causing Congenital Myopathies

  2014influential citation
• Pathogenetic mechanisms and genotype-phenotype correlations in nemaline myopathies and related disorders caused by mutations in tropomyosin genes and nebulin

  2014influential citation
• PLIN5 deletion remodels intracellular lipid composition and causes insulin resistance in muscle

  2014cites this paper
• Recent advances in nemaline myopathy

  2013cites this paper
• Muscle diseases with prominent joint contractures: Main entities and diagnostic strategy.

  2013cites this paper
• Polymorphism in tropomyosin structure and function

  2013cites this paper
• Skeletal muscle myopathy mutations at the actin tropomyosin interface that cause gain- or loss-of-function

  2013cites this paper
• Current world literature. Nerve, neuro-muscular junction and motor neuron diseases.

  2013cites this paper
• Mutations in repeating structural motifs of tropomyosin cause gain of function in skeletal muscle myopathy patients.

  2013cites this paper
• Clinical utility gene card for: Nemaline myopathy

  2012cites this paper