Functional characterization of equine dendritic cells propagated ex vivo using recombinant human GM-CSF and recombinant equine IL-4.

No abstract is available for this paper.

• Publication year

  1999

• Venue

  Veterinary Immunology and Immunopathology

• Publication date

  1999-11-30

• Fields of study

  Biology, Medicine

• Identifiers
  DOI 10.1016/S0165-2427(99)00094-XPMID 10587301
• External record

  Open on Semantic Scholar

• Source metadata

  Semantic Scholar, PubMed

• No claims are published for this paper.

• No concepts are published for this paper.

• In vitro isolation of a neutralization escape mutant of equine infectious anemia virus (EIAV)

  2005cited by this paper
• Molecular Cloning: A Laboratory Manual

  2001cited by this paper
• A particulate viral protein vaccine reduces viral load and delays progression to disease in immunized ponies challenged with equine infectious anemia virus.

  1999cited by this paper
• Dendritic Cells Efficiently Induce Protective Antiviral Immunity

  1998cited by this paper
• Dendritic cells and the control of immunity

  1998cited by this paper
• Equine monocyte-derived macrophage cultures and their applications for infectivity and neutralization studies of equine infectious anemia virus.

  1998cited by this paper
• Vaccination against Chlamydial Genital Tract Infection after Immunization with Dendritic Cells Pulsed Ex Vivo with Nonviable Chlamydiae

  1998cited by this paper
• Isolation and characterisation of pig Peyer's patch dendritic cells.

  1998cited by this paper
• Vaccination of melanoma patients with peptide- or tumorlysate-pulsed dendritic cells

  1998cited by this paper
• General method for the detection and in vitro expansion of equine cytolytic T lymphocytes.

  1998cited by this paper
• Maturation Stages of Mouse Dendritic Cells in Growth Factor–dependent Long-Term Cultures

  1997cited by this paper
• Allogeneic Dendritic Cell Induction of HIV-Specific Cytotoxic T Lymphocyte Responses from T Cells of HIV Type 1-Infected and Uninfected Individuals

  1997cited by this paper
• Isolation and characterisation of equine dendritic cells.

  1997cited by this paper
• Maturation of the cellular and humoral immune responses to persistent infection in horses by equine infectious anemia virus is a complex and lengthy process

  1997cited by this paper
• Purification and characterization of bovine dendritic cells from peripheral blood.

  1997cited by this paper
• T cell-mediated terminal maturation of dendritic cells.

  1997cited by this paper
• Chimpanzee dendritic cells with potent immunostimulatory function can be propagated from peripheral blood

  1996cited by this paper
• Vaccination of patients with B–cell lymphoma using autologous antigen–pulsed dendritic cells

  1996cited by this paper
• T cell-mediated terminal maturation of dendritic cells: loss of adhesive and phagocytotic capacities.

  1996cited by this paper
• The survival and growth of ovine afferent lymph dendritic cells in culture depends on tumour necrosis factor-alpha and is enhanced by granulocyte-macrophage colony-stimulating factor but inhibited by interferon-gamma.

  1995cited by this paper
• Dendritic cells use macropinocytosis and the mannose receptor to concentrate macromolecules in the major histocompatibility complex class II compartment: downregulation by cytokines and bacterial products

  1995cited by this paper
• In vitro recall of proliferative and cytolytic responses to minor histocompatibility antigens by dendritic cell enriched canine peripheral blood mononuclear cells.

  1995cited by this paper
• Targeting antigen into the phagocytic pathway in vivo induces protective tumour immunity

  1995cited by this paper
• The survival and growth of ovine afferent lymph dendritic cells in culture depends on tumour necrosis factor-α and is enhanced by granulocyte-macrophage colony-stimulating factor but inhibited by interferon-γ

  1995cited by this paper
• Molecular cloning and sequencing of equine interleukin 4.

  1994cited by this paper
• Efficient presentation of soluble antigen by cultured human dendritic cells is maintained by granulocyte/macrophage colony-stimulating factor plus interleukin 4 and downregulated by tumor necrosis factor alpha

  1994cited by this paper
• Proliferating dendritic cell progenitors in human blood

  1994cited by this paper
• Characterization of antigen-presenting cells that present exogenous antigens in association with class I MHC molecules.

  1993cited by this paper
• Molecular cloning and expression of equine interleukin 2.

  1993cited by this paper
• Efficient major histocompatibility complex class I presentation of exogenous antigen upon phagocytosis by macrophages.

  1993cited by this paper
• Generation of large numbers of dendritic cells from mouse bone marrow cultures supplemented with granulocyte/macrophage colony-stimulating factor

  1992cited by this paper
• Efficacy of inactivated whole-virus and subunit vaccines in preventing infection and disease caused by equine infectious anemia virus

  1992cited by this paper
• Dendritic cells pulsed with protein antigens in vitro can prime antigen- specific, MHC-restricted T cells in situ [published erratum appears in J Exp Med 1990 Oct 1;172(4):1275]

  1990cited by this paper
• A Laboratory manual

  1989cited by this paper
• Purification and characterization of recombinant human interleukin 4. Biological activities, receptor binding and the generation of monoclonal antibodies.

  1989cited by this paper
• Regulation of murine T cell proliferation by B cell stimulatory factor-1.

  1987cited by this paper
• Isolation and characterization of a human interleukin cDNA clone, homologous to mouse B-cell stimulatory factor 1, that expresses B-cell- and T-cell-stimulating activities.

  1986cited by this paper
• Isolation of equine infectious anemia virus glycoproteins. Lectin affinity chromatography procedures for high avidity glycoproteins.

  1983cited by this paper
• Amplification and expression of sequences cotransfected with a modular dihydrofolate reductase complementary dna gene.

  1982cited by this paper

• Flow cytometry analysis of CD11c-positive peripheral blood mononuclear cells in horses.

  2022cites this paper
• An allergen-fused dendritic cell-binding peptide enhances in vitro proliferation of equine T-cells and cytokine production.

  2021cites this paper
• Phenotypic characterization of equine monocyte-derived dendritic cells generated ex vivo utilizing commercially available serum-free medium.

  2020cites this paper
• Characterization of respiratory dendritic cells from equine lung tissues

  2017influential citation
• Interaction of EHV1 with equine dendritic cells and mesenchymal stem cells

  2016cites this paper
• Equine herpesvirus type 1 (EHV1) induces alterations in the immunophenotypic profile of equine monocyte-derived dendritic cells.

  2016cites this paper
• Can Levamisole Upregulate the Equine Cell Mediated Macrophage (M1) Dendritic Cell (DC1) CD4 T-helper 1 (Th1) CD8 T-cytotoxic 1 (Tc1) Immune Response in Vitro?

  2016cites this paper
• Characterisation of the equine macrophage/monocyte

  2015cites this paper
• THE ROLE OF LIPID ANTIGENS IN THE PROTECTION AGAINST RHODOCOCCAL PNEUMONIA

  2014cites this paper
• Enhanced protocol for CD14+ cell enrichment from equine peripheral blood via anti-human CD14 mAb and automated magnetic activated cell sorting.

  2013cites this paper
• The equine CD1 gene family is the largest and most diverse yet identified

  2013cites this paper
• Activation-Induced FoxP3 Expression Regulates Cytokine Production in Conventional T Cells Stimulated with Autologous Dendritic Cells

  2012cites this paper
• Autologous Dendritic Cells Conventional T Cells Stimulated with Regulates Cytokine Production in Activation-Induced FoxP3 Expression

  2012cites this paper
• Phenotypic And Functional Characterization Of Equine Monocyte-Derived Dendritic Cells

  2012influential citation
• EIAV epidemiologic Report in Portuguese feral Garranos populations

  2011cites this paper
• Bovine dendritic cells & their interaction with E.coli 0157:H7

  2011cites this paper
• A potential role for indoleamine 2,3-dioxygenase (IDO) in Rhodococcus equi infection.

  2010cites this paper
• A new strategy of immune evasion by influenza A virus: inhibition of monocyte differentiation into dendritic cells.

  2010cites this paper
• Identification of immunologically relevant genes in mare and foal dendritic cells responding to infection by Rhodococcus equi.

  2010cites this paper
• The role of dendritic cells in alphaherpesvirus infections: archetypes and paradigms

  2009cites this paper
• Cytokine-enhanced vaccine and suicide gene therapy as adjuvant treatments of metastatic melanoma in a horse

  2009cites this paper
• Cytokine expression by neutrophils of adult horses stimulated with virulent and avirulent Rhodococcus equi in vitro.

  2009cites this paper
• PATHOGENESIS OF INFLUENZA A VIRUS: INHIBITION OF MONOCYTE DIFFERETIATION INTO DENDRITIC CELL

  2009cites this paper
• Young foal and adult horse monocyte-derived dendritic cells differ by their degree of phenotypic maturity.

  2009cites this paper
• Ex vivo generation of mature equine monocyte-derived dendritic cells.

  2009cites this paper
• Characterization of an equine macrophage cell line: application to studies of EIAV infection.

  2009cites this paper
• GGGTGACGTGAGTAAACCTGAAC CCGTCCCGCGTGTTC AAGTGAACTCATCAAAGTGATGAATGA CGAAATGGATTCTGACTCCTCTTC TCGCCCAAAGCTAACCTGAGGAAGC GCTCCAGACGGTGCTTGTG GCCGATCACCCCAAAGTG TGTCGCAGGAGCCACCACGCT GAAAAAGACGGATGCTTCCAATCTG TCCGAAAGACCAGTGGTGATTTT CAGGTCTCCTGATTGAAC GCCACACTGCGAAAACTCA GCACAATAATCTGCACCCACTTTG ACGAGC

  2008cites this paper
• An improved method to generate equine dendritic cells from peripheral blood mononuclear cells: divergent maturation programs by IL-4 and LPS.

  2008influential citation
• EQUINE INNATE AND ADAPTIVE IMMUNITY TO VIRAL INFECTIONS

  2008cites this paper
• New assays to measure equine influenza virus-specific Type 1 immunity in horses.

  2007cites this paper
• Innate immunity to Rhodococcus equi: the response of adult and juvenile equine neutrophils

  2007cites this paper
• Woodchuck dendritic cells generated from peripheral blood mononuclear cells and transduced with recombinant human adenovirus serotype 5 induce antigen‐specific cellular immune responses

  2007cites this paper
• Validation of quantitative polymerase chain reaction assays for measuring cytokine expression in equine macrophages.

  2007cites this paper
• Screening of anti-human leukocyte monoclonal antibodies for reactivity with equine leukocytes.

  2007cites this paper
• Effects of antigen and recombinant porcine cytokines on pig dendritic cell cytokine expression in vitro.

  2006cites this paper
• "Dendritic cells in different animal species: an overview".

  2006cites this paper
• CD86 molecule is a specific marker for canine monocyte-derived dendritic cells.

  2006cites this paper
• Apparent elimination of EIAV ancestral species in a long-term inapparent carrier.

  2006cites this paper
• Monocyte‐derived dendritic cells from horses differ from dendritic cells of humans and mice

  2006cites this paper
• Equine infectious anemia virus-infected dendritic cells retain antigen presentation capability.

  2005cites this paper
• Toll-like receptor, MHC II, B7 and cytokine expression by porcine monocytes and monocyte-derived dendritic cells in response to microbial pathogen-associated molecular patterns.

  2005cites this paper
• Functional canine dendritic cells can be generated in vitro from peripheral blood mononuclear cells and contain a cytoplasmic ultrastructural marker.

  2005cites this paper
• Generation of dendritic cells from rabbit bone marrow mononuclear cell cultures supplemented with hGM-CSF and hIL-4.

  2005cites this paper
• Th-1/Th-2 type cytokine profiles of pig T-cells cultured with antigen-treated monocyte-derived dendritic cells.

  2004cites this paper
• IL-4 induced CD23 (FcepsilonRII) up-regulation in equine peripheral blood mononuclear cells and pulmonary alveolar macrophages.

  2004cites this paper
• The biology of dendritic cells and their potential use in veterinary medicine.

  2003cites this paper
• Immunophenotype and functional properties of feline dendritic cells derived from blood and bone marrow.

  2003cites this paper
• The biology of dendritic cells and their potential use in veterinary medicine

  2003cites this paper
• Characterisation of porcine monocyte-derived dendritic cells according to their cytokine profile.

  2003cites this paper
• Identification of equine herpesvirus-1 antigens recognized by cytotoxic T lymphocytes.

  2003cites this paper
• Mucosal co-administration of cholera toxin and influenza virus hemagglutinin-DNA in ponies generates a local IgA response.

  2003cites this paper
• Generation and characterization of ovine dendritic cells derived from peripheral blood monocytes

  2002cites this paper
• Modulating immune responses with dendritic cells: an attainable goal in veterinary medicine?

  2002cites this paper
• CHAPTER 7 – Isolation, culture and propagation of dendritic cells

  2001cites this paper
• Cloning of equine chemokines eotaxin, monocyte chemoattractant protein (MCP)-1, MCP-2 and MCP-4, mRNA expression in tissues and induction by IL-4 in dermal fibroblasts.

  2000cites this paper
• Journal of Immune Based Therapies and Vaccines the Effect of Cpg-odn on Antigen Presenting Cells of the Foal

  year unknowncites this paper