Characterization of a GDP-D-mannose 3'',5''-epimerase from rice.

No abstract is available for this paper.

• Publication year

  2006

• Venue

  Phytochemistry

• Publication date

  2006-02-01

• Fields of study

  Biology, Medicine, Chemistry

• Identifiers
  DOI 10.1016/J.PHYTOCHEM.2005.12.003PMID 16413588
• External record

  Open on Semantic Scholar

• Source metadata

  Semantic Scholar, PubMed

• No claims are published for this paper.

• No concepts are published for this paper.

• Molecular genetics of nucleotide sugar interconversion pathways in plants

  2004cited by this paper
• Ascorbic acid, a familiar small molecule intertwined in the response of plants to ozone, pathogens, and the onset of senescence

  2004cited by this paper
• Vitamin C : Its Functions and Biochemistry in Animals and Plants

  2004cited by this paper
• myo-Inositol Oxygenase Offers a Possible Entry Point into Plant Ascorbate Biosynthesis1

  2004cited by this paper
• Nucleotide sugar interconversions and cell wall biosynthesis: how to bring the inside to the outside.

  2004cited by this paper
• Improved prediction of signal peptides: SignalP 3.0.

  2004cited by this paper
• Biosynthesis of L-ascorbic acid in plants: new pathways for an old antioxidant.

  2004cited by this paper
• l-Galactose replaces l-fucose in the pectic polysaccharide rhamnogalacturonan II synthesized by the l-fucose-deficient mur1 Arabidopsis mutant

  2004cited by this paper
• Characterization of soluble and putative membrane-bound UDP-glucuronic acid decarboxylase (OsUXS) isoforms in rice.

  2004cited by this paper
• A highly specific L-galactose-1-phosphate phosphatase on the path to ascorbate biosynthesis.

  2004cited by this paper
• GDP-Mannose 3′,5′-Epimerase Forms GDP-L-gulose, a Putative Intermediate for the de Novo Biosynthesis of Vitamin C in Plants*

  2003cited by this paper
• The pathway of L-ascorbic acid biosynthesis in the colourless microalga Prototheca moriformis.

  2003cited by this paper
• Extensive feature detection of N-terminal protein sorting signals

  2002cited by this paper
• Antisense suppression of l-galactose dehydrogenase in Arabidopsis thaliana provides evidence for its role in ascorbate synthesis and reveals light modulated l-galactose synthesis.

  2002cited by this paper
• Amphiphilicity index of polar amino acids as an aid in the characterization of amino acid preference at membrane-water interfaces

  2002cited by this paper
• Molecular genetics of nucleotide sugar interconversion pathways in plants.

  2001cited by this paper
• BIOSYNTHESIS OF ASCORBIC ACID IN PLANTS: A Renaissance.

  2001cited by this paper
• Partial purification and identification of GDP-mannose 3",5"-epimerase of Arabidopsis thaliana, a key enzyme of the plant vitamin C pathway

  2001cited by this paper
• A high-performance liquid chromatography radio method for determination of L-ascorbic acid and guanosine 5'-diphosphate-l-galactose, key metabolites of the plant vitamin C pathway.

  2001cited by this paper
• Identification of Two GDP-6-deoxy-d-lyxo-4-hexulose Reductases Synthesizing GDP-d-rhamnose in Aneurinibacillus thermoaerophilus L420-91T *

  2001cited by this paper
• Recent advances in the role and biosynthesis of ascorbic acid in plants

  2001cited by this paper
• Ascorbic Acid in Plants: Biosynthesis and Function

  2000cited by this paper
• Preparative synthesis of GDP-beta-L-fucose by recombinant enzymes from enterobacterial sources.

  2000cited by this paper
• Ascorbic Acid in Plants: Biosynthesis and Function

  2000cited by this paper
• Plant L‐ascorbic acid: chemistry, function, metabolism, bioavailability and effects of processing

  2000cited by this paper
• Ascorbate biosynthesis in Arabidopsis cell suspension culture.

  1999cited by this paper
• The biosynthetic pathway of vitamin C in higher plants

  1998cited by this paper
• Mechanistic roles of tyrosine 149 and serine 124 in UDP-galactose 4-epimerase from Escherichia coli.

  1997cited by this paper
• The nicotinamide dinucleotide binding motif: a comparison of nucleotide binding proteins

  1996cited by this paper
• Short-chain dehydrogenases/reductases (SDR).

  1995cited by this paper
• CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice.

  1994cited by this paper
• Basic local alignment search tool.

  1990cited by this paper
• GDP-D-mannose: GDP-L-galactose epimerase from Chlorella pyrenoidosa.

  1982cited by this paper
• Observations on the mechanism of the reversible epimerization of GDP-D-mannose to GDP-L-galactose by an enzyme from Chlorella pyrenoidosa.

  1979cited by this paper
• The guanosine 5'-diphosphate D-mannose: guanosine 5'-diphosphate L-galactose epimerase of Chlorella pyrenoidosa. Chemical synthesis of guanosine 5'-diphosphate L-galactose and further studies of the enzyme and the reaction it catalyzes.

  1979cited by this paper
• A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding.

  1976cited by this paper
• The synthesis of guanosine 5'-diphosphate-l-Galactose by extracts of Chlorella pyrenoidosa.

  1975cited by this paper
• The synthesis of L-glucose by plant enzyme systems.

  1971cited by this paper
• L-ascorbic acid biosynthesis in higher plants from L-gulono-1, 4-lactone and L-galactono-1, 4-lactone.

  1970cited by this paper

• Response of Soil Phage Communities and Prokaryote-Phage Interactions to Long-Term Drought.

  2025cites this paper
• Advances in improving tomato fruit quality by gene editing

  2024cites this paper
• Deciphering the Genomic Characterization of the GGP Gene Family and Expression Verification of CmGGP1 Modulating Ascorbic Acid Biosynthesis in Melon Plants

  2024influential citation
• The ascorbate biosynthesis pathway in plants is known, but there is a way to go with understanding control and functions

  2024cites this paper
• A mutation in CsGME encoding GDP-mannose 3,5-epimerase results in little and wrinkled leaf in cucumber

  2024cites this paper
• Identification of the GDP-L-Galactose Phosphorylase Gene as a Candidate for the Regulation of Ascorbic Acid Content in Fruits of Capsicum annuum L.

  2023cites this paper
• Effects of Endogenous Melatonin Deficiency on the Growth, Productivity, and Fruit Quality Properties of Tomato Plants

  2023cites this paper
• Genetic and biochemical strategies for regulation of L-ascorbic acid biosynthesis in plants through the L-galactose pathway

  2023cites this paper
• GDP-Mannose 3,5-Epimerase: A View on Structure, Mechanism, and Industrial Potential

  2022influential citation
• De novo transcriptome analyses reveal multiple metabolic pathways for L-ascorbic acid biosynthesis under drought stress in Pugionium cornutum (L.) Gaertn

  2021cites this paper
• Enantiomers of Carbohydrates and Their Role in Ecosystem Interactions: A Review

  2020influential citation
• A CCAAT-binding factor, SlNFYA10, negatively regulates ascorbate accumulation by modulating the d-mannose/l-galactose pathway in tomato

  2020cites this paper
• Characterization of the First Bacterial and Thermostable GDP-Mannose 3,5-Epimerase

  2019influential citation
• Nickel-Pincer Nucleotide Cofactor-Containing Enzymes

  2019cites this paper
• Patterns of genome-wide allele-specific expression in hybrid rice and the implications on the genetic basis of heterosis

  2019cites this paper
• The response profile to chronic radiation exposure based on the transcriptome analysis of Scots pine from Chernobyl affected zone.

  2019cites this paper
• Vitamin C in fleshy fruits: biosynthesis, recycling, genes, and enzymes

  2019cites this paper
• Molecular Evolution of GDP-D-Mannose Epimerase (GME), a Key Gene in Plant Ascorbic Acid Biosynthesis

  2018influential citation
• Arabidopsis thaliana α1,2‐l‐fucosyltransferase catalyzes the transfer of l‐galactose to xyloglucan oligosaccharides

  2018cites this paper
• Arbuscular Mycorrhiza and Reactive Oxygen Species

  2017cites this paper
• Effective Synthesis of Guanosine 5′‐Diphospho‐β‐l‐galactose Using Bacterial l‐Fucokinase/Guanosine 5′‐Diphosphate‐l‐fucose Pyrophosphorylase

  2017cites this paper
• GDP-D-mannose epimerase regulates male gametophyte development, plant growth and leaf senescence in Arabidopsis

  2017cites this paper
• Isolation and Characterization of GDP-D-mannose 3, 5-epimerase (GME) Gene Impressive in Vitamin C Biosynthesis Pathway

  2017cites this paper
• Two tomato GDP-D-mannose epimerase isoforms involved in ascorbate biosynthesis play specific roles in cell wall biosynthesis and development

  2016cites this paper
• Ascorbate biosynthesis and its involvement in stress tolerance and plant development in rice (Oryza sativa L.)

  2015cites this paper
• Manipulation of the Rice L-Galactose Pathway: Evaluation of the Effects of Transgene Overexpression on Ascorbate Accumulation and Abiotic Stress Tolerance

  2015cites this paper
• Regulation of ascorbic acid biosynthesis and recycling during root development in carrot (Daucus carota L.).

  2015cites this paper
• Role of L-ascorbate in alleviating abiotic stresses in crop plants

  2014cites this paper
• Induction of tetraploidy in non-heading Chinese cabbage (Brassica campestris ssp. chinensis Makino) by colchicine treatment increases the ascorbic acid concentration

  2014cites this paper
• Gel-based comparative phosphoproteomic analysis on rice embryo during germination.

  2014cites this paper
• Overexpression of an alfalfa GDP-mannose 3, 5-epimerase gene enhances acid, drought and salt tolerance in transgenic Arabidopsis by increasing ascorbate accumulation

  2014cites this paper
• Ascorbic Acid in Plants

  2013cites this paper
• Molecular cloning and characterization of GDP-mannose-3′,5′-epimerase from Gracilaria changii

  2013influential citation
• Biosynthetic Mechanism for L-Gulose in Main Polar Lipids of Thermoplasma acidophilum and Possible Resemblance to Plant Ascorbic Acid Biosynthesis

  2013cites this paper
• Enzymes Involved in Ascorbate Biosynthesis and Metabolism in Plants

  2013cites this paper
• Expression pattern and promoter analysis of the gene encoding GDP-d-mannose 3′,5′-epimerase under abiotic stresses and applications of hormones by kiwifruit

  2013cites this paper
• Recycle HPLC: A Powerful Tool for the Purification of Natural Products

  2013cites this paper
• From Vitamin C to Metabolite Repair: The Role of Novel Sugar Nucleotide Phosphorylases

  2012cites this paper
• Impact of Oxidative Stress on Ascorbate Biosynthesis in Chlamydomonas via Regulation of the VTC2 Gene Encoding a

  2012cites this paper
• Leaf ascorbic acid level--is it really important for ozone tolerance in rice?

  2012cites this paper
• Regulati by arbuscular ycorrhizae of t e integrated physiological response to salinity in plants : new challenges in physiological and molecular studies

  2012cites this paper
• Regulation by arbuscular mycorrhizae of the integrated physiological response to salinity in plants: new challenges in physiological and molecular studies.

  2012cites this paper
• Impact of Oxidative Stress on Ascorbate Biosynthesis in Chlamydomonas via Regulation of the VTC2 Gene Encoding a GDP-l-galactose Phosphorylase*

  2012cites this paper
• l-galactose Phosphorylase Gene Encoding a VTC 2 Regulation of the via Chlamydomonas Biosynthesis in Impact of Oxidative Stress on Ascorbate Plant Biology :

  2012cites this paper
• Ectopic overexpression of peach GDP-d-mannose pyrophosphorylase and GDP-d-mannose-3′,5′-epimerase in transgenic tobacco

  2012influential citation
• Overexpression of SlGMEs leads to ascorbate accumulation with enhanced oxidative stress, cold, and salt tolerance in tomato

  2011cites this paper
• A Novel GDP-d-glucose Phosphorylase Involved in Quality Control of the Nucleoside Diphosphate Sugar Pool in Caenorhabditis elegans and Mammals*

  2011cites this paper
• Plant nucleotide sugar formation, interconversion, and salvage by sugar recycling.

  2011cites this paper
• Identification of Potential Gene Targets for the Improvement of Ascorbate Contents of Genetically Modified Plants

  2010cites this paper
• L-Ascorbate Biosynthesis in Peach Fruit : Change in L-Ascorbate Content during Fruit Development in Relation to L-Galactose Pathway-related Gene Expression

  2010cites this paper
• Analysis of genes involved in L-ascorbic acid biosynthesis during growth and ripening of grape berries.

  2010cites this paper
• AMR 1 , an Arabidopsis Gene That Coordinately and Negatively Regulates the Mannose / L-Galactose Ascorbic Acid Biosynthetic Pathway 1 [ OA ]

  2009cites this paper
• Ascorbic Acid Content of Blackcurrant Fruit is Influenced by Both Genetic and Environmental Factors

  2009cites this paper
• Expression profiling of ascorbic acid-related genes during tomato fruit development and ripening and in response to stress conditions

  2009influential citation
• AMR1, an Arabidopsis Gene That Coordinately and Negatively Regulates the Mannose/l-Galactose Ascorbic Acid Biosynthetic Pathway1[OA]

  2009cites this paper
• A Second GDP-l-galactose Phosphorylase in Arabidopsis en Route to Vitamin C

  2008cites this paper
• L-Ascorbate biosynthesis in higher plants: the role of VTC2.

  2008cites this paper
• Expression pattern of key vitamin C biosynthesis genes in apple.

  2007cites this paper
• The missing step of the l-galactose pathway of ascorbate biosynthesis in plants, an l-galactose guanyltransferase, increases leaf ascorbate content

  2007cites this paper
• The VTC2 cycle and the de novo biosynthesis pathways for vitamin C in plants: an opinion.

  2007cites this paper
• Pathway Engineering of the Plant Vitamin C Metabolic Network

  2007cites this paper
• CGCTACGATGTTACTGCCTGTGA CACCTCTTCCTGCCCAACTTTAGT DcGGP 2 CCTCGTGTTCTTGAGTGCTTACCA GTAGTATGCCTGGAAGTGAAGGTGATT DcGPP AACTGCTGCCAAGACTGGTTCTG ATGAATCTCCTATAAGCCCTCCTTCCT DcGalDH CCACCAGGCACCGTAGATGTAATC ATCACACCAACACCTTTGCTCTTCA DcGalLDH AGGTGGATAAGGAGAGGAAGATTGTG ACTGTGTCGGTATATGGTATGTAGAGA DcGalUR A

  year unknowncites this paper