Ascorbic acid formation and profiling of genes expressed in its synthesis and recycling in apple leaves of different ages.

No abstract is available for this paper.

• Publication year

  2010

• Venue

  Plant physiology and biochemistry : PPB

• Publication date

  2010-04-01

• Fields of study

  Biology, Medicine, Environmental Science

• Identifiers
  DOI 10.1016/j.plaphy.2010.01.015PMID 20159657
• External record

  Open on Semantic Scholar

• Source metadata

  Semantic Scholar, PubMed

• No claims are published for this paper.

• No concepts are published for this paper.

• Expression profiling of ascorbic acid-related genes during tomato fruit development and ripening and in response to stress conditions

  2009cited by this paper
• Gene expression studies in kiwifruit and gene over-expression in Arabidopsis indicates that GDP-L-galactose guanyltransferase is a major control point of vitamin C biosynthesis

  2009cited by this paper
• Gene expression of ascorbic acid biosynthesis related enzymes of the Smirnoff-Wheeler pathway in acerola (Malpighia glabra).

  2009cited by this paper
• A candidate gene survey of quantitative trait loci affecting chemical composition in tomato fruit

  2008cited by this paper
• Distribution and metabolism of ascorbic acid in apple fruits (Malus domestica Borkh cv. Gala)

  2008cited by this paper
• Tomato fruit ascorbic acid content is linked with monodehydroascorbate reductase activity and tolerance to chilling stress.

  2008cited by this paper
• L-Ascorbate biosynthesis in higher plants: the role of VTC2.

  2008cited by this paper
• l‐Galactono‐γ‐lactone dehydrogenase from Arabidopsis thaliana, a flavoprotein involved in vitamin C biosynthesis

  2008cited by this paper
• Overexpression of monodehydroascorbate reductase in transgenic tobacco confers enhanced tolerance to ozone, salt and polyethylene glycol stresses

  2007cited by this paper
• Arabidopsis VTC2 Encodes a GDP-l-Galactose Phosphorylase, the Last Unknown Enzyme in the Smirnoff-Wheeler Pathway to Ascorbic Acid in Plants*♦

  2007cited by this paper
• Light regulation of ascorbate biosynthesis is dependent on the photosynthetic electron transport chain but independent of sugars in Arabidopsis.

  2007cited by this paper
• Two genes in Arabidopsis thaliana encoding GDP-L-galactose phosphorylase are required for ascorbate biosynthesis and seedling viability.

  2007cited by this paper
• The role of ascorbic acid in the control of flowering time and the onset of senescence.

  2006cited by this paper
• Arabidopsis thaliana VTC4 Encodes L-Galactose-1-P Phosphatase, a Plant Ascorbic Acid Biosynthetic Enzyme*

  2006cited by this paper
• Progress in manipulating ascorbic acid biosynthesis and accumulation in plants

  2006cited by this paper
• Response of the ascorbate-glutathione cycle to re-aeration following hypoxia in lupine roots.

  2005cited by this paper
• Methyl jasmonate stimulates the de novo biosynthesis of vitamin C in plant cell suspensions.

  2005cited by this paper
• Ascorbic Acid Deficiency Activates Cell Death and Disease Resistance Responses in Arabidopsis1

  2005cited by this paper
• Biosynthesis and Catabolism of L-Ascorbic Acid in Plants

  2005cited by this paper
• RNA extraction from different apple tissues rich in polyphenols and polysaccharides for cDNA library construction

  2004cited by this paper
• Feedback inhibition of spinach L-galactose dehydrogenase by L-ascorbate.

  2004cited by this paper
• Distribution, developmental and stress responses of antioxidant metabolism in Malus

  2004cited by this paper
• Increasing vitamin C content of plants through enhanced ascorbate recycling

  2003cited by this paper
• GDP-Mannose 3′,5′-Epimerase Forms GDP-L-gulose, a Putative Intermediate for the de Novo Biosynthesis of Vitamin C in Plants*

  2003cited by this paper
• Antisense suppression of l-galactose dehydrogenase in Arabidopsis thaliana provides evidence for its role in ascorbate synthesis and reveals light modulated l-galactose synthesis.

  2002cited by this paper
• Ascorbate and glutathione: guardians of the cell cycle, partners in crime?

  2002cited by this paper
• Isoprene produced by leaves protects the photosynthetic apparatus against ozone damage, quenches ozone products, and reduces lipid peroxidation of cellular membranes.

  2001cited by this paper
• Plant L‐ascorbic acid: chemistry, function, metabolism, bioavailability and effects of processing

  2000cited by this paper
• Ascorbate biosynthesis in mitochondria is linked to the electron transport chain between complexes III and IV.

  2000cited by this paper
• The control of ascorbic acid synthesis and turnover in pea seedlings.

  2000cited by this paper
• Genetic evidence for the role of GDP-mannose in plant ascorbic acid (vitamin C) biosynthesis.

  1999cited by this paper
• Ascorbic acid metabolism in pea seedlings. A comparison of D-glucosone, L-sorbosone, and L-galactono-1,4-lactone as ascorbate precursors

  1999cited by this paper
• The biosynthetic pathway of vitamin C in higher plants

  1998cited by this paper
• Acclimation of leaf carotenoid composition and ascorbate levels to gradients in the light environment within an Australian rainforest

  1996cited by this paper
• Functional and molecular changes in the photosynthetic apparatus during senescence of flag leaves from field‐grown barley plants

  1996cited by this paper
• Purification and properties of L-galactono-gamma-lactone dehydrogenase, a key enzyme for ascorbic acid biosynthesis, from sweet potato roots.

  1995cited by this paper
• Chlorophyll Fluorescence Signatures of Leaves during the Autumnal Chlorophyll Breakdown

  1987cited by this paper
• A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding.

  1976cited by this paper
• Biological synthesis of L-ascorbic acid in animal tissues: conversion of L-gulonolactone into L-ascorbic acid.

  1960cited by this paper

• The regulatory module MdCPCL‐MdILR3L mediates the synthesis of ascorbic acid and anthocyanin in apple

  2025cites this paper
• Light intensity and photoperiod interact to alter the phytonutrient profile and light-use efficiency of mizuna grown for the space diet

  2025cites this paper
• Comparison of ascorbic acid metabolism during the development of two jujube varieties

  2025cites this paper
• Functional characterization of PavIAA6 in sweet cherry: a key regulator of pigmentation, flavor, and nutrient accumulation

  2025cites this paper
• "Alternative Pathways Leading to Ascorbate Biosynthesis in Plants: Lessons from the Last Twenty-five Years".

  2024cites this paper
• Biochemical and molecular responses of the ascorbate-glutathione cycle in wheat seedlings exposed to different forms of selenium.

  2024cites this paper
• Drought-mediated oxidative stress and its scavenging differ between citrus hybrids with medium and late fruit maturation

  2024cites this paper
• Identification of transcription factors contributing to vitamin C synthesis during Rosa roxburghii fruit development by integrating transcriptomics and metabolomics

  2024cites this paper
• Ascorbic acid metabolism is influenced by oxidation, recycling, synthesis and transport during fruit development of Malpighia emarginata

  2023cites this paper
• Promising role of selenium in mitigating the negative effects of iron deficiency in soybean leaves

  2023cites this paper
• L-Ascorbic acid metabolism and regulation in fruit crops.

  2023cites this paper
• Control of fruit softening and Ascorbic acid accumulation by manipulation of SlIMP3 in tomato

  2022cites this paper
• Analysis of enzymes and phenolic metabolites which affecting the anti-browning property of ‘Shannongsu’ pear

  2022cites this paper
• Sex-specific physiological and biochemical responses of Litsea cubeba under waterlogging stress

  2022cites this paper
• Elicitation of apigenin in green leafy vegetable plants and its molecular docking evaluation for effective anticancer applications

  2022cites this paper
• Ascorbic Acid Content and Transcriptional Profiling of Genes Involved in Its Metabolism during Development of Petals, Leaves, and Fruits of Orange (Citrus sinensis cv. Valencia Late)

  2021cites this paper
• Standard area diagram set for assessment of severity and temporal progress of apple blotch

  2021cites this paper
• Effects of water deficit on leaves and fruit quality during the development period in tomato plant

  2021cites this paper
• The role of glucose-6-phosphate dehydrogenase in reactive oxygen species metabolism in apple exocarp induced by acibenzolar-S-methyl.

  2020cites this paper
• The accumulation of ascorbic acid and lignin, and differential expression of ascorbic acid and lignin related-genes in yellow celery

  2020cites this paper
• Effects of 5-aminolevulinic Acid on the Bioactive Compounds and Seedling Growth of Oilseed Rape (Brassica napus L.)

  2019cites this paper
• Natural elicitors as preharvest treatments to improve postharvest quality of Butterhead lettuce

  2018cites this paper
• Differentially expressed protein and gene analysis revealed the effects of temperature on changes in ascorbic acid metabolism in harvested tea leaves

  2018cites this paper
• Ascorbate metabolism in vegetative and reproductive organs of "cherry" tomato

  2018cites this paper
• Genetic Control of Ascorbic Acid Biosynthesis and Recycling in Horticultural Crops

  2017influential citation
• Effect of electrostatic atomization on ascorbate metabolism in post-harvest

  2017cites this paper
• Plant Vitamin C: One Single Molecule with a Plethora of Roles

  2017cites this paper
• Expression profiles of the genes involved in l-ascorbic acid biosynthesis and recycling in Rosa roxburghii leaves of various ages

  2017influential citation
• Regulation of Ascorbic Acid Biosynthesis in Plants

  2017cites this paper
• Ascorbic acid metabolism during sweet cherry (Prunus avium) fruit development

  2017cites this paper
• Light regulates ascorbate in plants: An integrated view on physiology and biochemistry

  2017cites this paper
• Transcriptomic analysis of the biosynthesis, recycling, and distribution of ascorbic acid during leaf development in tea plant (Camellia sinensis (L.) O. Kuntze)

  2017cites this paper
• Predominant role of the l-galactose pathway in l-ascorbic acid biosynthesis in fruits and leaves of the Capsicum annuum L. chili pepper

  2016influential citation
• Antioxidant pool optimization in Carthamus tinctorius L. leaves under different NaCl levels and treatment durations

  2016influential citation
• Expression profiles of genes and enzymes related to ascorbic acid metabolism in fruits of Ziziphus jujuba Mill. ‘Jinsixiaozao’

  2016cites this paper
• Tartaric acid pathways in Vitis vinifera L. (cv. Ugni blanc): a comparative study of two vintages with contrasted climatic conditions

  2016influential citation
• Transcriptional profiling of genes involved in ascorbic acid biosynthesis, recycling, and degradation during three leaf developmental stages in celery

  2016cites this paper
• Regulation of ascorbic acid biosynthesis and recycling during root development in carrot (Daucus carota L.).

  2015cites this paper
• Regulation of ascorbic acid metabolism by blue LED light irradiation in citrus juice sacs.

  2015cites this paper
• Light avoidance reduces ascorbic acid accumulation in the peel of Citrus fruit.

  2015cites this paper
• Foliar application of ascorbate enhances the physiological and biochemical attributes of maize (Zea mays L.) cultivars under drought stress

  2015influential citation
• Overexpression of L-galactono-1,4-lactone dehydrogenase (L-GalLDH) gene correlates with increased ascorbate concentration and reduced browning in leaves of Lactuca sativa L. after cutting

  2015cites this paper
• L-Ascorbic acid metabolism during fruit development in an ascorbate-rich fruit crop chestnut rose (Rosa roxburghii Tratt).

  2014cites this paper
• Metal/metalloid stress tolerance in plants: role of ascorbate, its redox couple, and associated enzymes

  2014cites this paper
• ROLE OF ABSCISIC ACID (ABA) IN MODULATING THE RESPONSES OF TWO APPLE ROOTSTOCKS TO DROUGHT STRESS

  2014cites this paper
• Proteomic analysis of 'Zaosu' pear (Pyrus bretschneideri Rehd.) and its early-maturing bud sport.

  2014cites this paper
• Expression of GDP-L-galactose Pyrophosphatase and Its Relationship with Ascorbate Accumulation in Rosa roxburghii

  2014cites this paper
• Expression profiling of genes involved in ascorbate biosynthesis and recycling during fleshy root development in radish.

  2013influential citation
• Role of ascorbic acid in enhancing hypoxia tolerance in roots of sensitive and tolerant apple rootstocks

  2013cites this paper
• Expression pattern and promoter analysis of the gene encoding GDP-d-mannose 3′,5′-epimerase under abiotic stresses and applications of hormones by kiwifruit

  2013cites this paper
• Variation in phenolic constituents and antioxidant capacities of plant organs of three Cuban species of Pluchea Cass. (Asteraceae) under ex vitro and in vitro growth conditions

  2013cites this paper
• Expression patterns and promoter characteristics of the gene encoding Actinidia deliciosal-galactose-1-phosphate phosphatase involved in the response to light and abiotic stresses

  2013cites this paper
• Effect of electrostatic atomization on ascorbate metabolism in postharvest broccoli

  2012cites this paper
• Allelic Variation in Paralogs of GDP-l-Galactose Phosphorylase Is a Major Determinant of Vitamin C Concentrations in Apple Fruit1[C][W][OA]

  2012cites this paper
• Ascorbic Acid Accumulation and Expression of Genes Involved in Its Biosynthesis and Recycling in Developing Apple Fruit

  2011cites this paper
• Ascorbate Biosynthesis during Early Fruit Development Is the Main Reason for Its Accumulation in Kiwi

  2010cites this paper
• Shading the whole vines during young fruit development decreases ascorbate accumulation in kiwi.

  2010cites this paper
• CGCTACGATGTTACTGCCTGTGA CACCTCTTCCTGCCCAACTTTAGT DcGGP 2 CCTCGTGTTCTTGAGTGCTTACCA GTAGTATGCCTGGAAGTGAAGGTGATT DcGPP AACTGCTGCCAAGACTGGTTCTG ATGAATCTCCTATAAGCCCTCCTTCCT DcGalDH CCACCAGGCACCGTAGATGTAATC ATCACACCAACACCTTTGCTCTTCA DcGalLDH AGGTGGATAAGGAGAGGAAGATTGTG ACTGTGTCGGTATATGGTATGTAGAGA DcGalUR A

  year unknowncites this paper