Aberrant transcripts of the cyclin-dependent kinase-associated protein phosphatase in hepatocellular carcinoma.

No abstract is available for this paper.

• Publication year

  2000

• Venue

  Cancer Research

• Publication date

  2000-09-01

• Fields of study

  Biology, Medicine

• Identifiers
  PMID 10987270
• External record

  Open on Semantic Scholar

• Source metadata

  Semantic Scholar, PubMed

• No claims are published for this paper.

• No concepts are published for this paper.

• C dil, a Human Gl and S Phase Protein Phosphatase That Associates with Cdk2

  2003cited by this paper
• Effects of Phosphorylation of Threonine 160 on Cyclin-dependent Kinase 2 Structure and Activity*

  1999cited by this paper
• Molecular cloning of a defective hepatitis C virus genome from the ascitic fluid of a patient with hepatocellular carcinoma.

  1997cited by this paper
• The Cdk-activating kinase (CAK) from budding yeast.

  1996cited by this paper
• Regulatory roles of cyclin dependent kinase phosphorylation in cell cycle control.

  1996cited by this paper
• Cyclin-dependent kinase 7: at the cross-roads of transcription, DNA repair and cell cycle control?

  1996cited by this paper
• Dephosphorylation of Cdk2 Thr160 by the Cyclin-Dependent Kinase-Interacting Phosphatase KAP in the Absence of Cyclin

  1995cited by this paper
• The Wee1 protein kinase regulates T14 phosphorylation of fission yeast Cdc2.

  1995cited by this paper
• Early detection of anti-HCc antibody in acute hepatitis C virus (HCV) by western blot (immunoblot) using a recombinant HCV core protein fragment

  1994cited by this paper
• The decision to enter mitosis.

  1994cited by this paper
• KAP: a dual specificity phosphatase that interacts with cyclin-dependent kinases.

  1994cited by this paper
• Activation of the various cyclin/cdc2 protein kinases.

  1993cited by this paper
• Reversible tyrosine phosphorylation and cell cycle control.

  1993cited by this paper
• Formulation and application of a numerical scoring system for assessing histological activity in asymptomatic chronic active hepatitis

  1981cited by this paper

• The emerging roles of dual-specificity phosphatases and their specific characteristics in human cancer.

  2021cites this paper
• EPAC Negatively Regulates Myelination via Controlling Proliferation of Oligodendrocyte Precursor Cells

  2020cites this paper
• CDKN3 expression predicates poor prognosis and regulates adriamycin sensitivity in hepatocellular carcinoma in vitro

  2020cites this paper
• Cyclin-Dependent Kinase Inhibitor 3 Promoted Cell Proliferation by Driving Cell Cycle from G1 to S Phase in Esophageal Squamous Cell Carcinoma

  2019cites this paper
• Screening of potential biomarkers and their predictive value in early stage non-small cell lung cancer: a bioinformatics analysis.

  2019cites this paper
• CMAR_A_193793 3253..3264

  2019cites this paper
• A multiallelic indel in the promoter region of the Cyclin‐dependent kinase inhibitor 3 gene is significantly associated with body weight and carcass traits in chickens

  2019cites this paper
• CDKN3 promotes tumor progression and confers cisplatin resistance via RAD51 in esophageal cancer

  2019cites this paper
• Identification of candidate biomarkers and pathways associated with SCLC by bioinformatics analysis

  2018cites this paper
• Expression and alternative splicing of the cyclin-dependent kinase inhibitor-3 gene in human cancer.

  2017influential citation
• A critical role of CDKN 3 in gastric cancer and regulates tumor cell proliferation

  2016cites this paper
• CDKN3 expression is negatively associated with pathological tumor stage and CDKN3 inhibition promotes cell survival in hepatocellular carcinoma

  2016cites this paper
• Silencing cyclin-dependent kinase inhibitor 3 inhibits the migration of breast cancer cell lines

  2016cites this paper
• Growth Regulation in Hepatobiliary Cancer: Regulators of the Cell Division Cycle

  2016cites this paper
• Effects of Mutations of 3 Amino Acids on Hepatocellular Carcinoma

  2015cites this paper
• Identifying CDKN3 Gene Expression as a Prognostic Biomarker in Lung Adenocarcinoma via Meta-analysis

  2015cites this paper
• Mechanistic studies of cyclin-dependent kinase inhibitor 3 (CDKN3) in colorectal cancer.

  2015cites this paper
• Overexpression of major CDKN3 transcripts is associated with poor survival in lung adenocarcinoma

  2015influential citation
• CDKN3 mRNA as a Biomarker for Survival and Therapeutic Target in Cervical Cancer

  2015cites this paper
• AGCTGCACATCTATCATC CACTGGTGGTTTCATTTC CDK 1 ACCATACCCATTGACTAAC ATAAGCACATCCTGAAGAC POLD 1 GCAGGTCAAGGTCGTATC GAAGGAGCGTGGTGTAAC PCNA GCCTGACAAATGCTTGCTGAC TTGAGTGCCTCCAACACCTTC FEN 1 TGTTCTACCGCACCATTC AGGCTCAGCAGATGTTTG GAPDH CACCCACTCCTCCACCTTTG CCACCACCCTGTTGCTGTAG

  2015cites this paper
• The Tumor Suppressor Cdkn3 Is Required for Maintaining the Proper Number of Centrosomes by Regulating the Centrosomal Stability of Mps1.

  2015cites this paper
• Targeting CDKN3 in cervical cancer

  2014cites this paper
• CDKN3 is an independent prognostic factor and promotes ovarian carcinoma cell proliferation in ovarian cancer.

  2014cites this paper
• Expression and Function Analysis of Mitotic Checkpoint Genes Identifies TTK as a Potential Therapeutic Target for Human Hepatocellular Carcinoma

  2014cites this paper
• A Critical Role of CDKN3 in Bcr-Abl-Mediated Tumorigenesis

  2014cites this paper
• KAP regulates ROCK2 and Cdk2 in an RNA-activated glioblastoma invasion pathway

  2014cites this paper
• The tumor suppressor CDKN3 controls mitosis

  2013influential citation
• Antitumor activity of (R,R’)-4-methoxy-1-naphthylfenoterol in a rat C6 glioma xenograft model in the mouse

  2013cites this paper
• The role of PTPRK and PTPRM in prostate and breast cancer

  2013cites this paper
• Impact of oncogenic protein tyrosine phosphatases in cancer.

  2012cites this paper
• Wnt Signaling Network in Homo Sapiens

  2012cites this paper
• Overexpression of cyclin-dependent kinase-associated protein phosphatase enhances cell proliferation in renal cancer cells.

  2012cites this paper
• Cell Metabolism - Cell Homeostasis and Stress Response

  2012cites this paper
• Cyclin-dependent kinase-associated protein phosphatase is overexpressed in alcohol-related hepatocellular carcinoma and influences xenograft tumor growth

  2012cites this paper
• Cyclin-dependent kinase inhibitor 3 is overexpressed in hepatocellular carcinoma and promotes tumor cell proliferation.

  2012cites this paper
• SKY analysis revealed recurrent numerical and structural chromosome changes in BDII rat endometrial carcinomas

  2011cites this paper
• Inside the human cancer tyrosine phosphatome

  2010cites this paper
• Aberrant splicing of cyclin-dependent kinase-associated protein phosphatase KAP increases proliferation and migration in glioblastoma.

  2007influential citation
• Characterization and function of cks2-a cyclin dependent kinase regulatory subunit-during spermatogenesis

  2005cites this paper
• Integrative genomics based identification of potential human hepatocarcinogenesis-associated cell cycle regulators: RHAMM as an example.

  2005cites this paper
• Characterization of a HCV NS5A protein derived from a patient with hepatoma.

  2005cites this paper
• Effect of all-trans-retinoic acid on mRNA binding protein p62 in human gastric cancer cells.

  2005cites this paper
• Tyrosine phosphatases in cancer: Targets for therapeutic intervention

  2004cites this paper
• Abolishment of the interaction between cyclin-dependent kinase 2 and Cdk-associated protein phosphatase by a truncated KAP mutant.

  2003cites this paper
• Characterization of the porcine CDKN3 gene as a potential candidate for congenital splay leg in piglets

  2003influential citation
• Identification of a novel pre‐S2 mutation in a subgroup of chronic carriers with spontaneous clearance of hepatitis B virus surface antigen

  2003cites this paper
• Identification of a novel pre-S2 mutation in a subgroup of chronic carriers with spontaneous clearance of hepatitis B virus surface antigen.

  2002cites this paper
• Human HTm4 is a hematopoietic cell cycle regulator.

  2002cites this paper
• Regulation of cyclin-Cdk activity in mammalian cells

  2002cites this paper
• Contributions in the domain of cancer research: Review¶Negative regulators of cyclin-dependent kinases and their roles in cancers

  2001cites this paper