Cyclophilins contribute to Stat3 signaling and survival of multiple myeloma cells

No abstract is available for this paper.

• Publication year

  2009

• Venue

  Oncogene

• Publication date

  2009-08-06

• Fields of study

  Biology, Medicine

• Identifiers
  DOI 10.1038/onc.2009.142PMID 19503092
• External record

  Open on Semantic Scholar

• Source metadata

  Semantic Scholar, PubMed

• No claims are published for this paper.

• No concepts are published for this paper.

• Characterization of a cytosolic heat-shock protein-caveolin chaperone complex.

  2013cited by this paper
• Prolyl isomerase cyclophilin A regulation of Janus-activated kinase 2 and the progression of human breast cancer.

  2008cited by this paper
• Cyclophilin A up-regulates MMP-9 expression and adhesion of monocytes/macrophages via CD147 signalling pathway in rheumatoid arthritis

  2008cited by this paper
• Pin1 is required for the Ser727 phosphorylation-dependent Stat3 activity

  2007cited by this paper
• Overexpressed cyclophilin A in cancer cells renders resistance to hypoxia- and cisplatin-induced cell death.

  2007cited by this paper
• Interleukin-6 dependent survival of multiple myeloma cells involves the Stat3-mediated induction of microRNA-21 through a highly conserved enhancer.

  2007cited by this paper
• Cyclosporine and tacrolimus for the treatment of rheumatoid arthritis

  2007cited by this paper
• BCL3 is induced by IL-6 via Stat3 binding to intronic enhancer HS4 and represses its own transcription

  2006cited by this paper
• The role of IL-6 and STAT3 in inflammation and cancer.

  2005cited by this paper
• Role of Cyclophilin B in Activation of Interferon Regulatory Factor-3*

  2005cited by this paper
• Stable RNA interference-mediated suppression of cyclophilin A diminishes non-small-cell lung tumor growth in vivo.

  2005cited by this paper
• Cyclophilin B is a functional regulator of hepatitis C virus RNA polymerase.

  2005cited by this paper
• The cyclophilins

  2005influential reference
• Protein Expression Profiles in Pancreatic Adenocarcinoma Compared with Normal Pancreatic Tissue and Tissue Affected by Pancreatitis as Detected by Two-Dimensional Gel Electrophoresis and Mass Spectrometry

  2004cited by this paper
• Interleukin-6-dependent gene expression profiles in multiple myeloma INA-6 cells reveal a Bcl-2 family-independent survival pathway closely associated with Stat3 activation.

  2004cited by this paper
• Cyclophilin A Is Required for Retinoic Acid-induced Neuronal Differentiation in p19 Cells*

  2004cited by this paper
• Translating biomarkers into clinical practice: prognostic implications of cyclophilin A and macrophage migratory inhibitory factor identified from protein expression profiles in non-small cell lung cancer.

  2004cited by this paper
• Analysis of Stat3 (signal transducer and activator of transcription 3) dimerization by fluorescence resonance energy transfer in living cells.

  2004cited by this paper
• Essential Role of Caveolae in Interleukin-6- and Insulin-like Growth Factor I-triggered Akt-1-mediated Survival of Multiple Myeloma Cells*

  2003cited by this paper
• A novel and functional interaction between cyclophilin A and prolactin receptor

  2003cited by this paper
• High binding capacity of cyclophilin B to chondrocyte heparan sulfate proteoglycans and its release from the cell surface by matrix metalloproteinases: possible role as a proinflammatory mediator in arthritis.

  2003cited by this paper
• Regulation of NF-kappaB signaling by Pin1-dependent prolyl isomerization and ubiquitin-mediated proteolysis of p65/RelA.

  2003cited by this paper
• Nano-high-performance liquid chromatography in combination with nano-electrospray ionization Fourier transform ion-cyclotron resonance mass spectrometry for proteome analysis.

  2003cited by this paper
• Regulation of the tyrosine kinase Itk by the peptidyl-prolyl isomerase cyclophilin A

  2002cited by this paper
• The prolyl isomerase Pin1 reveals a mechanism to control p53 functions after genotoxic insults

  2002cited by this paper
• A System for Stable Expression of Short Interfering RNAs in Mammalian Cells

  2002cited by this paper
• Interaction of the retinoblastoma gene product, RB, with cyclophilin A negatively affects cyclosporin‐inhibited NFAT signaling

  2002cited by this paper
• The intranuclear prolactin/cyclophilin B complex as a transcriptional inducer

  2002cited by this paper
• Cyclophilins: unexpected messengers in intercellular communications.

  2002cited by this paper
• Interferon α extends the survival of human myeloma cells through an upregulation of the Mcl‐1 anti‐apoptotic molecule

  2001cited by this paper
• Cyclophilin A and Ess1 interact with and regulate silencing by the Sin3–Rpd3 histone deacetylase

  2000cited by this paper
• Role of cyclophilin B in prolactin signal transduction and nuclear retrotranslocation.

  2000cited by this paper
• Posttranslational regulation of IRF-4 activity by the immunophilin FKBP52.

  2000cited by this paper
• Constitutive activation of STAT3 is associated with the acquisition of an interleukin 6-independent phenotype by murine plasmacytomas and hybridomas.

  2000cited by this paper
• Constitutive activation of Stat3 signaling confers resistance to apoptosis in human U266 myeloma cells.

  1999cited by this paper
• Stat3 as an oncogene.

  1999cited by this paper
• Point mutations in v-Myb disrupt a cyclophilin-catalyzed negative regulatory mechanism.

  1998cited by this paper
• In vivo and in vitro activities of the gp130-stimulating designer cytokine Hyper-IL-6.

  1998cited by this paper
• Transcriptional Activation of the p21 WAF1,CIP1,SDI1 Gene by Interleukin-6 Type Cytokines

  1998cited by this paper
• Presence of Cyclophilin A in Synovial Fluids of Patients with Rheumatoid Arthritis

  1997cited by this paper
• Protein structure : a practical approach

  1997cited by this paper
• Cyclophilin B mediates cyclosporin A incorporation in human blood T-lymphocytes through the specific binding of complexed drug to the cell surface.

  1996cited by this paper
• Evidence that human milk isolated cyclophilin B corresponds to a truncated form.

  1996cited by this paper
• Differential Activation of Acute Phase Response Factor/STAT3 and STAT1 via the Cytoplasmic Domain of the Interleukin 6 Signal Transducer gp130

  1996cited by this paper
• Differential Activation of Acute Phase Response Factor/Stat3 and Stat1 via the Cytoplasmic Domain of the Interleukin 6 Signal Transducer gp130

  1996cited by this paper
• Prevention of myeloma cell apoptosis by ectopic bcl-2 expression or interleukin 6-mediated up-regulation of bcl-xL.

  1995cited by this paper
• Association of transcription factor APRF and protein kinase Jak1 with the interleukin-6 signal transducer gp130.

  1994cited by this paper
• The signalling pathways of interleukin-6 and gamma interferon converge by the activation of different transcription factors which bind to common responsive DNA elements

  1994cited by this paper
• Acute-phase response factor, a nuclear factor binding to acute-phase response elements, is rapidly activated by interleukin-6 at the posttranslational level

  1993cited by this paper
• Identification of cyclophilin as a proinflammatory secretory product of lipopolysaccharide-activated macrophages.

  1992cited by this paper
• Determination of kinetic constants for peptidyl prolyl cis-trans isomerases by an improved spectrophotometric assay.

  1991cited by this paper
• Tumorigenesis and Neoplastic Progression Expression of Cyclophilin B is Associated with Malignant Progression and Regulation of Genes Implicated in the Pathogenesis of Breast Cancer

  year unknowncited by this paper

• Multidimensional pan-cancer analysis reveals the impact of PPIA on tumor epigenetic modifications and immune regulation

  2025cites this paper
• Precision Editing of Cyclophilin A Generates Cyclosporine and Voclosporin Resistant Cellular Therapies

  2025cites this paper
• Proteostatic Remodeling of Small Heat Shock Chaperones─Crystallins by Ran-Binding Protein 2─and the Peptidyl-Prolyl cis-trans Isomerase and Chaperone Activities of Its Cyclophilin Domain.

  2024cites this paper
• The effects of CypA on apoptosis: potential target for the treatment of diseases

  2023cites this paper
• Cyclosporine A Downregulates Selenoprotein P Expression via a Signal Transducer and Activator of Transcription 3-Forkhead Box Protein O1 Pathway in Hepatocytes In Vitro.

  2022cites this paper
• Non‐Immunosuppressive Cyclophilin Inhibitors

  2022cites this paper
• Cell detoxification of secondary metabolites by P4-ATPase-mediated vesicle transport

  2022cites this paper
• High-fat diet induced cyclophilin B enhances STAT3/lncRNA-PVT1 feedforward loop and promotes growth and metastasis in colorectal cancer

  2022influential citation
• Cyclophilin A is a key positive and negative feedback regulator within interleukin‐6 trans‐signaling pathway

  2021cites this paper
• Virus–Host Interactions in Foot-and-Mouth Disease Virus Infection

  2021cites this paper
• CypB promotes cell proliferation and metastasis in endometrial carcinoma

  2020cites this paper
• Tandem mass tag labeling to characterize muscle-specific proteome changes in beef during early postmortem period.

  2020cites this paper
• CYPB upregulates and promotes cell proliferation in endometrial carcinoma

  2020cites this paper
• CypA: a Potential Target of Tumor Radiotherapy and/or Chemotherapy.

  2020cites this paper
• High expression level of peptidylprolyl isomerase A is correlated with poor prognosis of liver hepatocellular carcinoma

  2019cites this paper
• Positive Correlation between Activated CypA/CD147 Signaling and MMP-9 Expression in Mice Inflammatory Periapical Lesion

  2019cites this paper
• Cyclophilin B promotes cell proliferation, migration, invasion and angiogenesis via regulating the STAT3 pathway in non-small cell lung cancer.

  2019cites this paper
• Mechanism of cyclosporine A nephrotoxicity: Oxidative stress, autophagy, and signalings.

  2018cites this paper
• Cyclophilin A: A Key Factor in Virus Replication and Potential Target for Anti-viral Therapy.

  2017cites this paper
• Peptidyl-prolyl isomerase (PPIase): an emerging area in tumor biology

  2017cites this paper
• Cyclophilin A Aggravates Collagen-Induced Arthritis via Promoting Classically Activated Macrophages

  2017cites this paper
• Gastric Cancer Cell Proliferation and Survival Is Enabled by a Cyclophilin B/STAT3/miR-520d-5p Signaling Feedback Loop.

  2017cites this paper
• C Cyclophilin

  2017influential citation
• Cyclosporine A sensitizes human non-small cell lung cancer cells to gefitinib through inhibition of STAT3.

  2016cites this paper
• Proline isomerisation as a novel regulatory mechanism for p38MAPK activation and functions

  2016cites this paper
• Inhibition of Aβ(1-40) fibril formation by cyclophilins.

  2016cites this paper
• Cyclophilin A (CypA) Plays Dual Roles in Regulation of Bone Anabolism and Resorption

  2016cites this paper
• Interaction of cyclophilin A with a novel binding protein, SR-25, and characterization of their expression pattern in Chinese hepatocellular carcinoma patients.

  2016cites this paper
• Insights into peptidyl-prolyl cis-trans isomerase structure and function in immunocytes.

  2015cites this paper
• Cyclophilin A as a downstream effector of PI3K/Akt signalling pathway in multiple myeloma cells

  2015influential citation
• Novel Role for Cyclophilin A in Regulation of Chondrogenic Commitment and Endochondral Ossification

  2015cites this paper
• Cyclophilin function in Cancer; lessons from virus replication.

  2015cites this paper
• Targeting the cyclophilin domain of Ran-binding protein 2 (Ranbp2) with novel small molecules to control the proteostasis of STAT3, hnRNPA2B1 and M-opsin.

  2015cites this paper
• Secreted cyclophilin A mediates G1/S phase transition of cholangiocarcinoma cells via CD147/ERK1/2 pathway

  2015cites this paper
• Cyclophilin function in Cancer; lessons from virus replication.

  2015cites this paper
• Functional aspects of extracellular cyclophilins

  2014cites this paper
• RETRACTED: Cyclophilin A (CypA) Interacts with NF-κB Subunit, p65/RelA, and Contributes to NF-κB Activation Signaling

  2014cites this paper
• Cyclophilin B supports Myc and mutant p53-dependent survival of glioblastoma multiforme cells.

  2014influential citation
• Differential Loss of Prolyl Isomerase or Chaperone Activity of Ran-binding Protein 2 (Ranbp2) Unveils Distinct Physiological Roles of Its Cyclophilin Domain in Proteostasis*

  2014influential citation
• HAb18G/CD147 Promotes pSTAT3-Mediated Pancreatic Cancer Development via CD44s

  2013cites this paper
• HAb 18 G / CD 147 Promotes pSTAT 3-Mediated Pancreatic Cancer Development via CD 44 s

  2013cites this paper
• Analysis of the STAT3 interactome using in-situ biotinylation and SILAC.

  2013cites this paper
• Cyclophilin A as a New Therapeutic Target for Hepatitis C Virus-induced Hepatocellular Carcinoma

  2013cites this paper
• Cyclophilins in atherosclerosis: a new therapeutic target?

  2013cites this paper
• Low-salt diet and cyclosporine nephrotoxicity: changes in kidney cell metabolism.

  2012cites this paper
• Stat1 activation attenuates IL-6 induced Stat3 activity but does not alter apoptosis sensitivity in multiple myeloma

  2012cites this paper
• ACCACTTTGTACAAGAAAGCTGGGT 4 forward GGGGACAAGTTTGTACAAAAAAGCAGGCTTCACCATGCTGCGCCTCTCCGAACG 4 reverse GGGGACCACTTTGTACAAGAAAGCTGGGTTCTACTCCTTGGCGATGGCAA 5 reverse GGGGACCACTTTGTACAAGAAAGCTGGGTGCTCCTTGGCGATGGCAAAGG 6 forward GGGGACAAGTTTGTACAAAAAAGCAGGCTTCACCATGGATGAGAAGAAGAA 7 reverse GGGGACCACTTTGTA

  2012cites this paper
• From Drosophila to Humans: Reflections on the Roles of the Prolyl Isomerases and Chaperones, Cyclophilins, in Cell Function and Disease

  2012cites this paper
• Increased expression of extracellular matrix metalloproteinase inducer (CD147) in multiple myeloma: role in regulation of myeloma cell proliferation

  2012cites this paper
• Acetylation modulates the STAT signaling code.

  2012cites this paper
• Spatiotemporal behavior of nuclear cyclophilin B indicates a role in RNA transcription.

  2012cites this paper
• β-Actin is a downstream effector of the PI3K/AKT signaling pathway in myeloma cells

  2011cites this paper
• Proteomic Analysis for Malonylastragaloside I in U937 Leukemia Cells by Modified Label-free Quantitative Strategy with LC Chip Q-TOF MS/MS

  2011cites this paper
• Prolyl cis/trans isomerase signalling pathways in cancer.

  2011cites this paper
• Insights into immunophilin structure and function.

  2011cites this paper
• Role of cyclophilin B in tumorigenesis and cisplatin resistance in hepatocellular carcinoma in humans

  2011cites this paper
• Cyclophilin A as negative regulator of apoptosis by sequestering cytochrome c.

  2010cites this paper
• An Overview of Cyclophilins in Human Cancers

  2010cites this paper
• Molecular aspects of cyclophilins mediating therapeutic actions of their ligands

  2010cites this paper
• Knockdown of CypA inhibits interleukin-8 (IL-8) and IL-8-mediated proliferation and tumor growth of glioblastoma cells through down-regulated NF-κB

  2010cites this paper