Salinity-stimulated changes in expression and activity of two carbonic anhydrase isoforms in the blue crab Callinectes sapidus

No abstract is available for this paper.

• Publication year

  2007

• Venue

  Journal of Experimental Biology

• Publication date

  2007-07-01

• Fields of study

  Biology, Medicine, Environmental Science

• Identifiers
  DOI 10.1242/jeb.005041PMID 17575037
• External record

  Open on Semantic Scholar

• Source metadata

  Semantic Scholar, PubMed

• No claims are published for this paper.

• No concepts are published for this paper.

• Effect of Salinity on Osmoregulatory Patch Epithelia in Gills of the Blue Crab Callinectes sapidus

  2006cited by this paper
• The structure and function of carbonic anhydrase isozymes in the respiratory system of vertebrates.

  2006cited by this paper
• Osmoregulation and Na,K-ATPase expression in osmoregulatory organs of Scylla paramamosain.

  2006cited by this paper
• Expressed sequence tags from normalized cDNA libraries prepared from gill and hypodermal tissues of the blue crab, Callinectes sapidus.

  2006influential reference
• Functional evidence for the presence of a carbonic anhydrase repressor in the eyestalk of the euryhaline green crab Carcinus maenas

  2006cited by this paper
• Neuroendocrine regulation of carbonic anhydrase expression in the gills of the euryhaline green crab, Carcinus maenas.

  2006cited by this paper
• Localization and diurnal variations of carbonic anhydrase mRNA expression in the inner ear of the rainbow trout Oncorhynchus mykiss.

  2006cited by this paper
• A transcriptomic approach of salinity response in the euryhaline teleost, Dicentrarchus labrax.

  2006cited by this paper
• Expression Profiles of Na+,K+-ATPase during Acute and Chronic Hypo-osmotic Stress in the Blue Crab Callinectes sapidus

  2006influential reference
• Gill area, permeability and Na+ ,K+ -ATPase activity as a function of size and salinity in the blue crab, Callinectes sapidus.

  2006cited by this paper
• Quantitative changes in branchial carbonic anhydrase activity and expression in the euryhaline green crab, Carcinus maenas, in response to low salinity exposure.

  2006cited by this paper
• Cytoplasmic carbonic anhydrase isozymes in rainbow trout Oncorhynchus mykiss: comparative physiology and molecular evolution

  2005cited by this paper
• Possible role of carbonic anhydrase, V-H(+)-ATPase, and Cl(-)/HCO3- exchanger in electrogenic ion transport across the gills of the euryhaline crab Chasmagnathus granulatus.

  2005cited by this paper
• Induction of branchial ion transporter mRNA expression during acclimation to salinity change in the euryhaline crab Chasmagnathus granulatus

  2005cited by this paper
• The multifunctional fish gill: dominant site of gas exchange, osmoregulation, acid-base regulation, and excretion of nitrogenous waste.

  2005cited by this paper
• Critical salinity, sensitivity, and commitment of salinity-mediated carbonic anhydrase induction in the gills of two euryhaline species of decapod crustaceans.

  2005cited by this paper
• Comparative physiology and molecular analysis of carbonic anhydrase from the red blood cells of teleost fish

  2004cited by this paper
• Comparative physiology and molecular evolution of carbonic anhydrase in the erythrocytes of early vertebrates.

  2003cited by this paper
• Salinity-mediated carbonic anhydrase induction in the gills of the euryhaline green crab, Carcinus maenas.

  2003cited by this paper
• Characterization of erythrocyte carbonic anhydrase in an ancient fish, the longnose gar (Lepisosteus osseus)

  2002cited by this paper
• Differential induction of branchial carbonic anhydrase and NA(+)/K(+) ATPase activity in the euryhaline crab, Carcinus maenas, in response to low salinity exposure.

  2002cited by this paper
• Quantification of mRNA using real-time reverse transcription PCR (RT-PCR): trends and problems.

  2002cited by this paper
• Environmentally mediated carbonic anhydrase induction in the gills of euryhaline crustaceans.

  2001influential reference
• Early carbonic anhydrase induction in the gills of the blue crab, Callinectes sapidus, during low salinity acclimation is independent of ornithine decarboxylase activity.

  2001influential reference
• Na(+)+K(+)-ATPase in gills of the blue crab Callinectes sapidus: cDNA sequencing and salinity-related expression of alpha-subunit mRNA and protein.

  2001cited by this paper
• Osmoregulation by Gills of Euryhaline Crabs: Molecular Analysis of Transporters1

  2001cited by this paper
• Expression of arginine kinase enzymatic activity and mRNA in gills of the euryhaline crabs Carcinus maenas and Callinectes sapidus.

  2000cited by this paper
• Evolution and distribution of the carbonic anhydrase gene families.

  2000cited by this paper
• Carbon dioxide transport and carbonic anhydrase in blood and muscle.

  2000cited by this paper
• The chloride cell: structure and function in the gills of freshwater fishes.

  1997cited by this paper
• Gapped BLAST and PSI-BLAST: a new generation of protein database search programs.

  1997cited by this paper
• Isolation and Characterization of a Carbonic Anhydrase Homologue from the Zebrafish (Danio rerio)

  1997cited by this paper
• Multiple roles of carbonic anhydrase in cellular transport and metabolism.

  1996cited by this paper
• Functional diversity, conservation, and convergence in the evolution of the alpha-, beta-, and gamma-carbonic anhydrase gene families.

  1996cited by this paper
• OSMOTIC REGULATION IN CRUSTACEANS

  1995cited by this paper
• A comparison of the gill physiology of two euryhaline crab species, Callinectes sapidus and Callinectes similis: energy production, transport-related enzymes and osmoregulation as a function of acclimation salinity

  1995cited by this paper
• Gills and Lungs : The Exchange of Gases and Ions

  1992cited by this paper
• The Carbonic anhydrases : cellular physiology and molecular genetics

  1991cited by this paper
• Microscopic anatomy of invertebrates

  1991cited by this paper
• Ultrastructural changes in the gill epithelium of the green crab Carcinus maenas in relation to the external salinity.

  1989cited by this paper
• Diel metabolic and activity patterns of the lemon shark (Negaprion brevirostris)

  1988cited by this paper
• Multiple sequence alignment with hierarchical clustering.

  1988cited by this paper
• Dynamics of Salinity Adaptations in the Euryhaline Crayfish Pacifasticus leniusculus

  1988cited by this paper
• Subcellular distribution of carbonic anhydrase activity in the gills of the blue crab, Callinectes sapidus

  1988influential reference
• NaCl Transport in Gills and Related Structures

  1988cited by this paper
• Carbonic anhydrases.

  1987cited by this paper
• Membrane-associated carbonic anhydrase in gills of the blue crab, Callinectes sapidus.

  1987cited by this paper
• An analysis of 5'-noncoding sequences from 699 vertebrate messenger RNAs.

  1987cited by this paper
• Transport Processes, Iono- and Osmoregulation

  1985cited by this paper
• CARBONIC ANHYDRASE ACTIVITY AND CALCIUM DEPOSITION DURING THE MOLT CYCLE OF THE BLUE CRAB CALLINECTES SAPIDUS

  1985cited by this paper
• Ion Transport in Crustacean Gills: Physiological and Ultrastructural Approaches

  1985cited by this paper
• ACID-BASE BALANCE IN CALLINECTES SAPIDUS DURING ACCLIMATION FROM HIGH TO LOW SALINITY

  1982influential reference
• Salinity adaption of gill Na, K‐ATPase in the blue crab, Callinectes sapidus

  1980cited by this paper
• NaCl balance in blue crabs,Callinectes sapidus, in fresh water

  1978cited by this paper
• Neuroendocrine Regulation

  1970cited by this paper
• Osmotic and ionic regulation.

  1968cited by this paper
• The Absolute Activity of Choline-Esterase

  1936cited by this paper
• Journal of experimental biology

  year unknowncited by this paper

• Genome-wide identification, functions, and expression analysis of carbonic anhydrase gene family in the gills of O. niloticus under salinity stress

  2026cites this paper
• Assessing Molecular Mechanisms of Stress Induced Salinity Adaptation in the Juvenile Ornate Spiny Lobster, Panulirus ornatus

  2025cites this paper
• Understanding the genomics responses of freshwater zooplanktons to salinization: a research hotspot in a saltier world.

  2025cites this paper
• Purification, Characterization, cDNA Cloning, and Bioinformatic Analysis of Zinc-Binding Protein from Magallana hongkongensis

  2024cites this paper
• Characterization of two carbonic anhydrase isoforms in the pulmonate snail (Lymnaea Stagnalis) and their involvement in Molluskan calcification.

  2024cites this paper
• Identifying low salinity adaptation gene expression in the anterior and posterior gills of the mud crab (Scylla paramamosain) by transcriptomic analysis.

  2023cites this paper
• How Do Gene Expression Patterns Change in Response to Osmotic Stresses in Kuruma Shrimp (Marsupenaeus japonicus)?

  2022cites this paper
• Exploring the versatility of the perfused crustacean gill as a model for transbranchial transport processes.

  2021cites this paper
• Osmotic and ionic regulation, and kinetic characteristics of a posterior gill (Na+, K+)-ATPase from the blue crab Callinectes danae on acclimation to salinity challenge

  2021cites this paper
• Osmotic and ionic regulation, and modulation by protein kinases, FXYD2peptide and ATP of gill (Na+, K+)-ATPase activity, in the swamp ghost crab Ucides cordatus (Brachyura, Ocypodidae).

  2020cites this paper
• Effect of salinity on modulation by ATP, protein kinases and FXYD2 peptide of gill (Na+, K+)-ATPase activity in the swamp ghost crab Ucides cordatus (Brachyura, Ocypodidae)

  2020cites this paper
• Euryhalinity of subtropical marine and estuarine polychaetes evaluated through carbonic anhydrase activity and cell volume regulation.

  2020cites this paper
• Characterization, functional analysis, and expression levels of three carbonic anhydrases in response to pH and saline–alkaline stresses in the ridgetail white prawn Exopalaemon carinicauda

  2019cites this paper
• Cloning and characterisation of Na+/K+-ATPase and carbonic anhydrase from oriental river prawn Macrobrachium nipponense.

  2019cites this paper
• Disparate responses to salinity across species and organizational levels in anchialine shrimps

  2019influential citation
• Metabolic responses and arginine kinase expression of juvenile cuttlefish (Sepia pharaonis) under salinity stress.

  2018cites this paper
• Effects of the recombinant crustacean hyperglycemic hormones rCHH-B1 and rCHH-B2 on the osmo-ionic regulation of the shrimp Litopenaeus vannamei exposed to acute salinity stress

  2018cites this paper
• Molecular Characterization of a Dual Domain Carbonic Anhydrase From the Ctenidium of the Giant Clam, Tridacna squamosa, and Its Expression Levels After Light Exposure, Cellular Localization, and Possible Role in the Uptake of Exogenous Inorganic Carbon

  2018influential citation
• Short- and long-term salinity challenge, osmoregulatory ability, and (Na+, K+)-ATPase kinetics and α-subunit mRNA expression in the gills of the thinstripe hermit crab Clibanarius symmetricus (Anomura, Diogenidae).

  2018cites this paper
• Exogenous 20-hydroxyecdysone induces epidermal carbonic anhydrase but inhibits exoskeletal calcification in the post-ecdysial blue crab, Callinectes sapidus.

  2018cites this paper
• Color Phase—Specific Ion Regulation of the European Green Crab Carcinus maenas in an Oscillating Salinity Environment

  2017cites this paper
• Homeostatic responses of crustaceans to salinity changes

  2017cites this paper
• Comparative molecular analyses of select pH- and osmoregulatory genes in three freshwater crayfish Cherax quadricarinatus, C. destructor and C. cainii

  2017cites this paper
• Molecular characterization of a cDNA encoding Na+/K+/2Cl- cotransporter in the gill of mud crab (Scylla paramamosain) during the molt cycle: Implication of its function in osmoregulation.

  2017cites this paper
• Expression patterns of two carbonic anhydrase genes, Na+/K+-ATPase and V-type H+-ATPase, in the freshwater crayfish, Cherax quadricarinatus, exposed to low pH and high pH

  2017cites this paper
• Molecular cloning and sequence analysis of two carbonic anhydrase in the swimming crab Portunus trituberculatus and its expression in response to salinity and pH stress.

  2016cites this paper
• Salinity-induced changes in gene expression from anterior and posterior gills of Callinectes sapidus (Crustacea: Portunidae) with implications for crustacean ecological genomics.

  2016influential citation
• Immunocytochemical localization of V-H(+) -ATPase, Na(+) /K(+) -ATPase, and carbonic anhydrase in gill lamellae of adult freshwater euryhaline shrimp Macrobrachium acanthurus (Decapoda, Palaemonidae).

  2015cites this paper
• Analysis, characterisation and expression of gill-expressed carbonic anhydrase genes in the freshwater crayfish Cherax quadricarinatus.

  2015influential citation
• Expression patterns of two Carbonic anhydrase genes, Na + /K + -ATPase and V-type H + -ATPase in the freshwater crayfish, Cherax quadricarinatus, under different pH

  2015influential citation
• Research in the Early Twenty-First Century: The Year-Round Research Program Comes of Age

  2015cites this paper
• Cloning and expression analysis of two carbonic anhydrase genes in white shrimp Litopenaeus vannamei, induced by pH and salinity stresses

  2015cites this paper
• Gill-specific (Na(+), K(+))-ATPase activity and α-subunit mRNA expression during low-salinity acclimation of the ornate blue crab Callinectes ornatus (Decapoda, Brachyura).

  2015cites this paper
• Digital gene expression analysis in hemocytes of the white shrimp Litopenaeus vannamei in response to low salinity stress.

  2015cites this paper
• Overview of 30 years of research on solubility trapping in Chinese karst

  2015cites this paper
• Transcriptional Adaptations to Low Salinity in Euryhaline Crustaceans

  2014influential citation
• Functional Characterization of Neuroendocrine Regulation of Branchial Carbonic Anhydrase Induction in the Euryhaline Crab Callinectes sapidus

  2014cites this paper
• The evolution of metazoan α-carbonic anhydrases and their roles in calcium carbonate biomineralization

  2014cites this paper
• Osmoregulation in the Hawaiian anchialine shrimp Halocaridina rubra (Crustacea: Atyidae): expression of ion transporters, mitochondria-rich cell proliferation and hemolymph osmolality during salinity transfers

  2014influential citation
• Identification of potential markers and sensitive tissues for low or high salinity stress in an intertidal mud crab (Macrophthalmus japonicus).

  2014cites this paper
• Disturbance in the anchialine ecosystem: ramifications for ecology and physiology

  2014influential citation
• Carbonic anhydrase induction in euryhaline crustaceans is rate-limited at the post-transcriptional level.

  2014cites this paper
• Osmoregulation and excretion.

  2014cites this paper
• A COMPARISON OF CARBONIC ANHYDRASE AMONG INVERTEBRATES, WITH A FOCUS ON CEPHALOPODS

  2013cites this paper
• Altered expression of Na(+)/K(+)-ATPase and other osmoregulatory genes in the gills of euryhaline animals in response to salinity transfer: a meta-analysis of 59 quantitative PCR studies over 10 years.

  2013cites this paper
• Analysis of evolution of carbonic anhydrases IV and XV reveals a rich history of gene duplications and a new group of isozymes.

  2013cites this paper
• AGRONOMIC AND PHYSIOLOGICAL CHARACTERISTICS AND PROTEOMIC EXPRESSION IN NEAR-ISOGENIC LINES OF BT AND NON-BT GLANDLESS COTTON

  2012influential citation
• Multiple functions of the crustacean gill: osmotic/ionic regulation, acid-base balance, ammonia excretion, and bioaccumulation of toxic metals

  2012cites this paper
• Down-regulation of activity and expression of three transport-related proteins in the gills of the euryhaline green crab, Carcinus maenas, in response to high salinity acclimation.

  2011cites this paper
• CTGTAGCTCGTGTTGTATCGCCGTTAATAAGGATGGAAAGTTTGAGGTTG GCTGTACGAAGATGAGAAGTGGTGGATAATGGAGAGTGAGGAGGATGAGG CTTCTCATCCCAATCAGACTGTATCTTCTTCCCTACGGCTTCTCAAACTC TCACTCGTCCTCTGGGCTGAGATCAACATCTAATTTATGTAAGGGTGTGG AATATCGTACAATAGTTAGTAACGTGGAGGGCGACATCTTTGCACTTCTG CCTGTAGATAATCACTCCTCATTCTTTGGACGTTAAGGAACCAAG

  2011influential citation
• Microarray-detected changes in gene expression in gills of green crabs (Carcinus maenas) upon dilution of environmental salinity.

  2011cites this paper
• mRNA Expression and activity of ion‐transporting proteins in gills of the blue crab Callinectes sapidus: Effects of waterborne copper

  2011cites this paper
• Physiological responses of Daphnia pulex to acid stress

  2009cites this paper
• Na,K-ATPase activity and epithelial interfaces in gills of the freshwater shrimp Macrobrachium amazonicum (Decapoda, Palaemonidae).

  2009cites this paper
• Evolutionary history of Na,K-ATPases and their osmoregulatory role

  2009cites this paper
• Gene expression and activity of carbonic anhydrase in salinity stressed Penaeus monodon.

  2009cites this paper
• The effects of CO2 and external buffering on ammonia excretion and Rhesus glycoprotein mRNA expression in rainbow trout

  2008cites this paper
• Osmotic and Ionic Regulation in Aquatic Arthropods

  2008cites this paper
• Differential expression and induction of two carbonic anhydrase isoforms in the gills of the euryhaline green crab, Carcinus maenas, in response to low salinity.

  2008cites this paper