Antibody Repertoire Development in Fetal and Neonatal Piglets. II. Characterization of Heavy Chain Complementarity-Determining Region 3 Diversity in the Developing Fetus1 2

No abstract is available for this paper.

• Publication year

  2000

• Venue

  Journal of Immunology

• Publication date

  2000-12-15

• Fields of study

  Biology, Medicine

• Identifiers
  DOI 10.4049/jimmunol.165.12.6999PMID 11120827
• External record

  Open on Semantic Scholar

• Source metadata

  Semantic Scholar, PubMed

• No claims are published for this paper.

• No concepts are published for this paper.

• Antibody repertoire development in fetal and neonatal piglets. V. VDJ gene chimeras resembling gene conversion products are generated at high frequency by PCR in vitro.

  2000cited by this paper
• Diversity in the CDR3 region of V(H) is sufficient for most antibody specificities.

  2000cited by this paper
• Early Ontogeny of Thymocytes in Pigs: Sequential Colonization of the Thymus by T Cell Progenitors1

  2000cited by this paper
• Receptor selection in B and T lymphocytes.

  2000cited by this paper
• B Lymphopoiesis in the Thymus1

  2000cited by this paper
• Antibody repertoire development in fetal and newborn piglets, III. Colonization of the gastrointestinal tract selectively diversifies the preimmune repertoire in mucosal lymphoid tissues

  2000cited by this paper
• IgM heavy chain complementarity-determining region 3 diversity is constrained by genetic and somatic mechanisms until two months after birth.

  1999influential reference
• Ligand recognition by alpha beta T cell receptors.

  1998cited by this paper
• LIGAND RECOGNITION BY T CELL RECEPTORS

  1998cited by this paper
• Antibody repertoire development in fetal and neonatal piglets. I. Four VH genes account for 80 percent of VH usage during 84 days of fetal life.

  1998cited by this paper
• Multiple Sites of Vλ Diversification in Cattle

  1998cited by this paper
• Prenatal ontogeny of lymphocyte subpopulations in pigs

  1998cited by this paper
• Terminal deoxynucleotidyl transferase expression during neonatal life alters D(H) reading frame usage and Ig-receptor-dependent selection of V regions.

  1998cited by this paper
• Multiple sites of V lambda diversification in cattle.

  1998cited by this paper
• V(H) repertoire maturation during B cell development in vitro: differential selection of Ig heavy chains by fetal and adult B cell progenitors.

  1997cited by this paper
• Use of a single VH family and long CDR3s in the variable region of cattle Ig heavy chains.

  1997cited by this paper
• A single predominantly expressed polymorphic immunoglobulin VH gene family, related to mammalian group, I, clan, II, is identified in cattle.

  1997cited by this paper
• Immunoglobulin Gene Organization and the Mechanism of Repertoire Development

  1997cited by this paper
• Molecular characterization of VDJ transcripts from a newborn piglet

  1996cited by this paper
• Substrate nucleotide-determined non-templated addition of adenine by Taq DNA polymerase: implications for PCR-based genotyping and cloning.

  1996cited by this paper
• The swine Ig heavy chain locus has a single JH and no identifiable IgD.

  1996cited by this paper
• Isotype and antibody specificity of spontaneously formed immunoglobulins in pig fetuses and germ‐free piglets: production by CD5− B cells

  1996cited by this paper
• The VDJ repertoire expressed in human preB cells reflects the selection of bona fide heavy chains

  1996cited by this paper
• Thymic B cells of pig fetuses and germ‐free pigs spontaneously produce IgM, IgG and IgA: detection by ELISPOT method

  1996cited by this paper
• Rabbit DQ52 and DH gene expression in early B-cell development.

  1996cited by this paper
• Somatic hypermutation of immunoglobulin genes.

  1996cited by this paper
• Modulation of non-templated nucleotide addition by Taq DNA polymerase: primer modifications that facilitate genotyping.

  1996cited by this paper
• Frequency of VH81x usage during B cell development: initial decline in usage is independent of Ig heavy chain cell surface expression.

  1996cited by this paper
• Fetal versus Adult PreB or B Cells: The Human VH Repertoire a

  1995cited by this paper
• Hypermutation generating the sheep immunoglobulin repertoire is an antigen-independent process.

  1995cited by this paper
• Gene conversion generates immunoglobulin gene diversity in cattle

  1995cited by this paper
• Fetal VDJ gene repertoire in rabbit: evidence for preferential rearrangement of VH1

  1995cited by this paper
• Modifiers of the human mucosal immune system

  1995cited by this paper
• Expressed swine VH genes belong to a small VH gene family homologous to human VHIII.

  1994cited by this paper
• Anatomy of the antibody molecule.

  1994cited by this paper
• Neonatal VH, D, and JH gene usage in rabbit B lineage cells.

  1994cited by this paper
• Rabbit IgH sequences in appendix germinal centers: VH diversification by gene conversion-like and hypermutation mechanisms.

  1994cited by this paper
• Overusage of Mouse DH Gene Segment, DFL16.1, Is Strain-Dependent and Determined by cis-Acting Elements

  1994cited by this paper
• Genomic clone for sandbar shark lambda light chain: generation of diversity in the absence of gene rearrangement.

  1993cited by this paper
• Human cord blood antibody repertoire. Mixed population of VH gene segments and CDR3 distribution in the expressed C alpha and C gamma repertoires.

  1993cited by this paper
• Excision products of TCR V alpha recombination contain in-frame rearrangements: evidence for continued V(D)J recombination in TCR+ thymocytes.

  1993cited by this paper
• Multiple rearrangements in T cell receptor alpha chain genes maximize the production of useful thymocytes

  1993cited by this paper
• Predominance of VH-D-JH junctions occurring at sites of short sequence homology results in limited junctional diversity in neonatal antibodies.

  1992cited by this paper
• Emergence of committed B lymphoid progenitors in the developing chicken embryo.

  1992cited by this paper
• Enumeration and characterization of DJH structures in mouse fetal liver.

  1992cited by this paper
• Restricted utilization of germ‐line VH3 genes and short diverse third complementarity‐determining regions (CDR3) in human fetal B lymphocyte immunoglobulin heavy chain rearrangements

  1992cited by this paper
• Helix-loop-helix transcription factor E47 activates germ-line immunoglobulin heavy-chain gene transcription and rearrangement in a pre-T-cell line.

  1991cited by this paper
• Comparison of D, JH, and junctional diversity in the fetal, adult, and aged B cell repertoires.

  1991cited by this paper
• Somatic generation of diversity in a mammalian primary lymphoid organ: the sheep ileal Peyer's patches.

  1991cited by this paper
• VDJ genes in VHa2 allotype-suppressed rabbits. Limited germline VH gene usage and accumulation of somatic mutations in D regions.

  1991cited by this paper
• B cell development in the bone marrow.

  1990cited by this paper
• Somatic diversification of immunoglobulin heavy chain VDJ genes: evidence for somatic gene conversion in rabbits.

  1990cited by this paper
• B cell development in the bone marrow.

  1990cited by this paper
• Preferential utilization of conserved immunoglobulin heavy chain variable gene segments during human fetal life.

  1990cited by this paper
• Somatic diversification of the chicken immunoglobulin light-chain gene.

  1990cited by this paper
• Frequency of VH-gene utilization in human EBV-transformed B-cell lines: the most JH-proximal VH segment encodes autoantibodies.

  1989cited by this paper
• Analysis of variable region genes encoding a human anti-DNA antibody of normal origin. Implications for the molecular basis of human autoimmune responses.

  1989cited by this paper
• Dual genotype in cutaneous T cell lymphoma: immunoglobulin gene rearrangement in clonal T cell malignancy.

  1989cited by this paper
• Immunoglobulin-producing cells in the human thymus.

  1988cited by this paper
• Dual genotype in cutaneous T cell lymphoma: immunoglobulin gene rearrangement in clonal T cell malignancy.

  1988cited by this paper
• Unusual phenotype of B cells in the thymus of normal mice

  1988cited by this paper
• A hyperconversion mechanism generates the chicken light chain preimmune repertoire.

  1987cited by this paper
• The chicken B cell compartment.

  1987cited by this paper
• Ontogeny of B cells in the chicken. I. Sequential development of clonal diversity in the bursa

  1976cited by this paper
• Studies on the relative synthesis and distribution of IgA and IgG1 in various tissues and body fluids of the cow.

  1972cited by this paper
• Development of the humoral immune response of the pig.

  1971cited by this paper
• PLASMOCYTES IN THE THYMUS OF THE NORMAL RAT.

  1965cited by this paper

• Genomic Profiling of Antibody Repertoire in Rongchang Pigs Uncovers Conserved V(D)J Gene Usage and Breed-Specific Diversification

  2026cites this paper
• Porcine B cell receptor repertoire uncovers balanced recognition of antigenic structures on serotype Asia1 foot-and-mouth disease virus

  2026cites this paper
• Comparative Aspects of Immunoglobulin Gene Rearrangement Arrays in Different Species

  2022cites this paper
• A Rapid Method for Direct Quantification of Antibody Binding-Site Concentration in Serum

  2022cites this paper
• Consequences of the different order of immunoglobulin gene rearrangements in swine.

  2021cites this paper
• High-throughput sequencing of the porcine antibody repertoire with or without PEDV infection: A proof-of-concept study.

  2021cites this paper
• Organogenesis of Ileal Peyer's Patches Is Initiated Prenatally and Accelerated Postnatally With Comprehensive Proliferation of B Cells in Pigs

  2020cites this paper
• T cells in swine completely rearrange immunoglobulin heavy chain genes.

  2019cites this paper
• 7 Immunoglobulin Polygeny : An Evolutionary Perspective

  2019cites this paper
• Sexual Dimorphism in Immune Development and in Response to Nutritional Intervention in Neonatal Piglets

  2019cites this paper
• Characterization and comparative analysis of immunoglobulin lambda chain diversity in a neonatal porcine model.

  2018cites this paper
• Postnatal development of the mucosal immune system and consequences on health in adulthood

  2018cites this paper
• Antibody Repertoire Development in Swine.

  2017cites this paper
• Weaning stress and gastrointestinal barrier development: Implications for lifelong gut health in pigs

  2017cites this paper
• Progress in the use of swine in developmental immunology of B and T lymphocytes.

  2016cites this paper
• WITHDRAWN: Crossbred Commercial Pigs immunoglobulin lambda chain usage diversity fluctuation after born

  2016cites this paper
• Appendix III – Collection, Handling, and Analysis of Specimens for Studies of Mucosal Immunity in Animals of Veterinary Importance

  2015cites this paper
• Bovine Immunoglobulin Genetics: A Phylogenetic Perspective

  2014cites this paper
• Immunoglobulin Genes in Tetrapods

  2014cites this paper
• Marsupial And Monotreme Immunoglobulin Genetics

  2014cites this paper
• Diversity of immunoglobulin lambda light chain gene usage over developmental stages in the horse.

  2014cites this paper
• Hematopoiesis in the equine fetal liver suggests immune preparedness

  2014cites this paper
• Generation of the Antibody Repertoire in Rabbits: Role of Gut-Associated Lymphoid Tissues

  2014cites this paper
• The Immunoglobulin Genes Of Bats

  2014cites this paper
• Inmunoglobulina G y su receptor Fc durante la placentación porcina

  2014cites this paper
• Application of high-throughput sequencing for the analyses of PRRSV-host interactions

  2014cites this paper
• Expansion of the Preimmune Antibody Repertoire by Junctional Diversity in Bos taurus

  2014influential citation
• Bovine B cells: Antibody repertoire diversification in fetal cattle

  2014cites this paper
• The comparative profile of lymphoid cells and the T and B cell spectratype of germ-free piglets infected with viruses SIV, PRRSV or PCV2

  2014cites this paper
• Development of gut immunoglobulin A production in piglet in response to innate and environmental factors.

  2014cites this paper
• The enigma of the lower gut‐associated lymphoid tissue (GALT)

  2013cites this paper
• Ontogeny of the avian intestinal immunoglobulin repertoire: modification in CDR3 length and conserved VH-pseudogene usage.

  2013cites this paper
• Marginal zone B cells: virtues of innate-like antibody-producing lymphocytes

  2013cites this paper
• Chain Cdr3 Developmental Changes in the Human Heavy

  2013cites this paper
• Antibody repertoire development in fetal and neonatal piglets. XIV. Highly restricted IGKV gene usage parallels the pattern seen with IGLV and IGHV.

  2013cites this paper
• Antibody repertoire dynamics in the changing landscape of infection

  2013cites this paper
• Antibody repertoire development in fetal and neonatal piglets. XII. Three IGLV genes comprise 70% of the pre-immune repertoire and there is little junctional diversity.

  2013cites this paper
• Dietary supplementation with Bifidobacterium lactis NCC2818 from weaning reduces local immunoglobulin production in lymphoid-associated tissues but increases systemic antibodies in healthy neonates.

  2013cites this paper
• Antibody repertoire development in fetal and neonatal piglets. XVI. Influenza stimulates adaptive immunity, class switch and diversification of the IgG repertoire encoded by downstream Cγ genes

  2013cites this paper
• Antibody repertoire development in fetal and neonatal piglets. XXII. λ rearrangement precedes κ rearrangement during B‐cell lymphogenesis in swine

  2012cites this paper
• Direct detection of antibody concentration and affinity in human serum using microscale thermophoresis.

  2012cites this paper
• The Porcine Antibody Repertoire: Variations on the Textbook Theme

  2012cites this paper
• Early Postnatal B Cell Ontogeny and Antibody Repertoire Maturation in the Opossum, Monodelphis domestica

  2012cites this paper
• Bovine B cells : B lymphopoiesis and the Generation of Primary Immunoglobulin Repertoire in Fetal Cattle

  2012cites this paper
• Required for B Cell Maintenance Antigen Dependent, and They Are Not Patches, Their Repertoire Development Is Lymphogenesis Is Absent in the Ileal Peyer's and Neonatal Piglets. XX. B Cell Antibody Repertoire Development in Fetal

  2011cites this paper
• Antibody repertoire development in fetal and neonatal piglets XXI. Usage of most VH genes remains constant during fetal and postnatal development.

  2011influential citation
• Antibody Repertoire Development in Fetal and Neonatal Piglets. XX. B Cell Lymphogenesis Is Absent in the Ileal Peyer’s Patches, Their Repertoire Development Is Antigen Dependent, and They Are Not Required for B Cell Maintenance

  2011cites this paper
• Immunoglobulin Polygeny: An Evolutionary Perspective

  2011cites this paper
• Review: Postnatal development of the mucosal immune system and consequences on health in adulthood

  2010cites this paper
• Antibody Repertoire Development in Fetal and Neonatal Piglets. XI. The Relationship of Variable Heavy Chain Gene Usage and the Genomic Organization of the Variable Heavy Chain Locus

  2010cites this paper
• IgA Antibody Response of Swine to Foot-and-Mouth Disease Virus Infection and Vaccination

  2010cites this paper
• Chain Locus Heavy Genomic Organization of the Variable Variable Heavy Chain Gene Usage and the and Neonatal Piglets. XI. The Relationship of Antibody Repertoire Development in Fetal

  2010cites this paper
• CAGT AGTACCTACATTAAC T TGGCA GCTATTAGTACTAGT VHB B B GACAACGCTTTCAGC TGG GCCATTGCTAGTAGTGAC VHG G E TTCAGT AGTTATAGCATGGAGC GGTATTGATAGTGGTAGTTA VHE E E TCAGT AGTTATGCAGTGAGC T GGTATTGATAGTGGTAGTTA VHF F F GT AGTTATGGCGTAGGC TGG TCTATTGGTAGTGGTA VHC C C GT AGTTATGAAATCAGC TG GGTATTTATAGTAGTGGTAG

  2010influential citation
• Isolator and other neonatal piglet models in developmental immunology and identification of virulence factors*

  2009influential citation
• Influencia del ambiente sobre la microbiota comensal del intestino de la rata

  2009cites this paper
• Immunoglobulins, antibody repertoire and B cell development.

  2009cites this paper
• Porcine Reproductive and Respiratory Syndrome Virus Subverts Repertoire Development by Proliferation of Germline-Encoded B Cells of All Isotypes Bearing Hydrophobic Heavy Chain CDR31

  2008cites this paper
• The role of microbiota and probiotics in stress-induced gastro-intestinal damage.

  2008cites this paper
• The ontogeny of the porcine immune system

  2008cites this paper
• The piglet as a model for B cell and immune system development

  2008influential citation
• Antibody Repertoire Development in Fetal and Neonatal Piglets: XIX. Undiversified B Cells with Hydrophobic HCDR3s Preferentially Proliferate in the Porcine Reproductive and Respiratory Syndrome1

  2007cites this paper
• The isolator piglet: a model for studying the development of adaptive immunity

  2007cites this paper
• Antibody Repertoire Development in Fetal and Neonatal Piglets. XVII. IgG Subclass Transcription Revisited with Emphasis on New IgG31

  2006cites this paper
• New IgG 3 Transcription Revisited with Emphasis on and Neonatal Piglets . XVII . IgG Subclass Antibody Repertoire Development in Fetal

  2006cites this paper
• Antibody repertoire development in swine.

  2006cites this paper
• Development of the neonatal B and T cell repertoire in swine: implications for comparative and veterinary immunology.

  2006cites this paper
• Channel catfish immunoglobulins: repertoire and expression.

  2006cites this paper
• Antibody Repertoire Development in Fetal and Neonatal Piglets. XIII. Hybrid VH Genes and the Preimmune Repertoire Revisited1

  2006cites this paper
• Developmental Changes in the Human Heavy Chain CDR3

  2005cites this paper
• Lymphocyte development in fetal piglets: facts and surprises.

  2005cites this paper
• The pre-immune variable kappa repertoire of swine is selectively generated from certain subfamilies of Vkappa2 and one Jkappa gene.

  2005cites this paper
• Comparison of the expressed porcine Vbeta and Jbeta repertoire of thymocytes and peripheral T cells.

  2005cites this paper
• Developmental progression of immunoglobulin heavy chain diversity in sheep.

  2005cites this paper
• The pre-immune variable kappa repertoire of swine is selectively generated from certain subfamilies of Vκ2 and one Jκ gene

  2005cites this paper
• Comparison of the expressed porcine Vβ and Jβ repertoire of thymocytes and peripheral T cells

  2005cites this paper
• Antibody repertoire development in fetal and neonatal piglets. XI. The thymic B‐cell repertoire develops independently from that in blood and mesenteric lymph nodes

  2005cites this paper
• Antibody Repertoire Development in Fetal and Neonatal Piglets. IX. Three Pathogen-Associated Molecular Patterns Act Synergistically to Allow Germfree Piglets to Respond to Type 2 Thymus-Independent and Thymus-Dependent Antigens1

  2005cites this paper
• Prenatal development of the porcine TCR δ repertoire: dominant expression of an invariant T cell receptor Vδ3‐Jδ3 chain

  2004cites this paper
• Characterization of porcine CD19 and anti-CD19 monoclonal antibodies.

  2004cites this paper
• CHAPTER 28 – Immunoglobulin Genes and Generation of Antibody Repertoires in Higher Vertebrates: A Key Role for GALT

  2004cites this paper
• Cloning of porcine scFv antibodies by phage display and expression in Escherichia coli.

  2004cites this paper
• Antibody Repertoire Development in Fetal and Neonatal Pigs. VII. Characterization of the Preimmune κ Light Chain Repertoire1

  2004cites this paper
• Prenatal development of the porcine TCR delta repertoire: dominant expression of an invariant T cell receptor Vdelta3-Jdelta3 chain.

  2004cites this paper
• Expressed murine and human CDR-H3 intervals of equal length exhibit distinct repertoires that differ in their amino acid composition and predicted range of structures.

  2003cites this paper
• Antibody Repertoire Development in Fetal and Neonatal Piglets. VI. B Cell Lymphogenesis Occurs at Multiple Sites with Differences in the Frequency of In-frame Rearrangements1

  2003cites this paper
• Influence of antibody diversification on the mechanism of haplotype exclusion of immunoglobulin gene expression.

  2002cites this paper
• B cell development and VDJ rearrangement in the fetal pig.

  2002cites this paper
• Switch recombination in fetal porcine thymus is uncoupled from somatic mutation.

  2002cites this paper
• Antibody Repertoire Development in Fetal and Neonatal Piglets. VIII. Colonization Is Required for Newborn Piglets to Make Serum Antibodies to T-Dependent and Type 2 T-Independent Antigens1

  2002cites this paper
• Evolution of IgM, IgE and IgG1–4 antibody responses in early childhood monitored with recombinant allergen components: implications for class switch mechanisms

  2002cites this paper
• Characterization of monoclonal antibodies recognizing immunoglobulin kappa and lambda chains in pigs by flow cytometry.

  2001cites this paper
• Antibody Repertoire Development in Fetal And Neonatal Piglets. IV. Switch Recombination, Primarily in Fetal Thymus, Occurs Independent of Environmental Antigen and Is Only Weakly Associated with Repertoire Diversification1

  2001cites this paper
• Characterization of monoclonal antibodies recognizing immunoglobulin κ and λ chains in pigs by flow cytometry

  2001cites this paper
• Antibody repertoire development in fetal and neonatal piglets. V. VDJ gene chimeras resembling gene conversion products are generated at high frequency by PCR in vitro.

  2000cites this paper
• Porcine IgA allotypes are not equally transcribed or expressed in heterozygous swine.

  2000cites this paper