TGF‐β signaling is dynamically regulated during the alveolarization of rodent and human lungs

No abstract is available for this paper.

• Publication year

  2008

• Venue

  Developmental Dynamics

• Publication date

  2008-01-01

• Fields of study

  Biology, Medicine

• Identifiers
  DOI 10.1002/dvdy.21403PMID 18095342
• External record

  Open on Semantic Scholar

• Source metadata

  Semantic Scholar, PubMed

• No claims are published for this paper.

• No concepts are published for this paper.

• TGF-beta-neutralizing antibodies improve pulmonary alveologenesis and vasculogenesis in the injured newborn lung.

  2007cited by this paper
• Temporal and spatial regulation of bone morphogenetic protein signaling in late lung development

  2007cited by this paper
• The transforming growth factor-β/Smad2,3 signalling axis is impaired in experimental pulmonary hypertension

  2007cited by this paper
• ALK-5 mediates endogenous and TGF-beta1-induced expression of connective tissue growth factor in embryonic lung.

  2007cited by this paper
• Dysregulated Bone Morphogenetic Protein Signaling in Monocrotaline-Induced Pulmonary Arterial Hypertension

  2007cited by this paper
• Role of endogenous TGF-beta in glucocorticoid-induced lung type II cell differentiation.

  2007cited by this paper
• The transforming growth factor-beta/Smad2,3 signalling axis is impaired in experimental pulmonary hypertension.

  2007cited by this paper
• Hyperoxia modulates TGF-beta/BMP signaling in a mouse model of bronchopulmonary dysplasia.

  2007cited by this paper
• Mechanisms of induction of airway smooth muscle hyperplasia by transforming growth factor-beta.

  2007cited by this paper
• Constitutive homo- and hetero-oligomerization of TβRII-B, an alternatively spliced variant of the mouse TGF-β type II receptor

  2006cited by this paper
• Constitutive homo- and hetero-oligomerization of TbetaRII-B, an alternatively spliced variant of the mouse TGF-beta type II receptor.

  2006cited by this paper
• Trans-differentiation of Alveolar Epithelial Type II Cells to Type I Cells Involves Autocrine Signaling by Transforming Growth Factor β1 through the Smad Pathway*

  2006cited by this paper
• Induction of the plasminogen activator system by mechanical stimulation of human bronchial epithelial cells.

  2006cited by this paper
• Similarities and dissimilarities of branching and septation during lung development

  2005cited by this paper
• Abnormal mouse lung alveolarization caused by Smad3 deficiency is a developmental antecedent of centrilobular emphysema.

  2005cited by this paper
• Growth factors, postnatal lung growth and bronchopulmonary dysplasia.

  2004cited by this paper
• Smad3 Null Mice Develop Airspace Enlargement and Are Resistant to TGF-β-Mediated Pulmonary Fibrosis1

  2004cited by this paper
• Conditional overexpression of bioactive transforming growth factor-beta1 in neonatal mouse lung: a new model for bronchopulmonary dysplasia?

  2004cited by this paper
• Lung development and fetal lung growth.

  2004influential reference
• Transfer of the active form of transforming growth factor-beta 1 gene to newborn rat lung induces changes consistent with bronchopulmonary dysplasia.

  2003cited by this paper
• Genetic Control of Lung Development

  2003cited by this paper
• Induction of Connective Tissue Growth Factor by Angiotensin II: Integration of Signaling Pathways

  2003cited by this paper
• Activin receptor-like kinase 1 is implicated in the maturation phase of angiogenesis.

  2002cited by this paper
• Regulation of TGF-beta ligand and receptor expression in neonatal rat lungs exposed to chronic hypoxia.

  2002cited by this paper
• Molecular regulation of lung development.

  2001cited by this paper
• Smad7 and Smad6 Differentially Modulate Transforming Growth Factor β-induced Inhibition of Embryonic Lung Morphogenesis*

  2000cited by this paper
• Transforming growth factor β2, but not β1 and β3, is critical for early rat lung branching

  2000cited by this paper
• Ontogeny and localization of TGF-beta type I receptor expression during lung development.

  2000cited by this paper
• The molecular basis of lung morphogenesis.

  2000cited by this paper
• Human Pulmonary Acinar Aplasia: Reduction of Transforming Growth Factor-β Ligands and Receptors

  1999cited by this paper
• TGF-beta signal transduction.

  1998influential reference
• Abrogation of Smad3 and Smad2 or of Smad4 gene expression positively regulates murine embryonic lung branching morphogenesis in culture.

  1998influential reference
• Transforming growth factor-beta selectively inhibits branching morphogenesis but not tubulogenesis.

  1997cited by this paper
• A human transforming growth factor-beta type II receptor that contains an insertion in the extracellular domain.

  1996cited by this paper
• Abrogation of transforming growth factor-beta type II receptor stimulates embryonic mouse lung branching morphogenesis in culture.

  1996cited by this paper
• Expression of transforming growth factor-beta type II receptor in rat lung is regulated during development.

  1995cited by this paper
• Expression of transforming growth factor-beta 1, -beta 2, and -beta 3 mRNA and protein in the murine lung.

  1991cited by this paper
• Expression of Transforming Growth Factor-β1, -β2, and -β3 mRNA and Protein in the Murine Lung

  1991cited by this paper
• Type beta transforming growth factor is the primary differentiation-inducing serum factor for normal human bronchial epithelial cells.

  1986cited by this paper

• Proteoglycans and Hyaluronan in Normal and Aberrant Lung Development

  2025cites this paper
• Descriptive and Functional Genomics in Neonatal Respiratory Distress Syndrome: From Lung Development to Targeted Therapies

  2024cites this paper
• TGF-β controls alveolar type 1 epithelial cell plasticity and alveolar matrisome gene transcription in mice

  2024cites this paper
• Nitric Oxide Regulation of Fetal and Newborn Lung Development and Function.

  2024cites this paper
• TSPYL1 as a Critical Regulator of TGFβ Signaling through Repression of TGFBR1 and TSPYL2

  2024cites this paper
• Perinatal origins of bronchopulmonary dysplasia—deciphering normal and impaired lung development cell by cell

  2023cites this paper
• TGFβ controls alveolar type 1 epithelial cell plasticity and alveolar matrisome gene transcription

  2023cites this paper
• CXCL10 deficiency limits macrophage infiltration, preserves lung matrix, and enables lung growth in bronchopulmonary dysplasia

  2023cites this paper
• Complex roles of TGF-β signaling pathways in lung development and bronchopulmonary dysplasia

  2023cites this paper
• When inflammation meets lung development—an update on the pathogenesis of bronchopulmonary dysplasia

  2022cites this paper
• Immune Response Is Key to Genetic Mechanisms of SARS-CoV-2 Infection With Psychiatric Disorders Based on Differential Gene Expression Pattern Analysis

  2022cites this paper
• In utero delivery of miRNA induces epigenetic alterations and corrects pulmonary pathology in congenital diaphragmatic hernia

  2022cites this paper
• The Role of Insulin Receptor Substrate Proteins in Bronchopulmonary Dysplasia and Asthma: New Potential Perspectives

  2022cites this paper
• Association of immune cell recruitment and BPD development

  2022cites this paper
• Opposing Effects of TGFβ and BMP in the Pulmonary Vasculature in Congenital Diaphragmatic Hernia

  2021cites this paper
• MicroRNAs for Virus Pathogenicity and Host Responses, Identified in SARS-CoV-2 Genomes, May Play Roles in Viral-Host Co-Evolution in Putative Zoonotic Host Species

  2021cites this paper
• Developmental Pathways Underlying Lung Development and Congenital Lung Disorders

  2021cites this paper
• Lung development and immune status under chronic LPS exposure in rat pups with and without CD26/DPP4 deficiency

  2021cites this paper
• Lung and eye disease develop concurrently in supplemental oxygen-exposed neonatal mice.

  2020cites this paper
• Low Dose Hyperoxia Primes Airways for Fibrosis in Mice after Influenza A Infection

  2020cites this paper
• Stretch regulates alveologenesis and homeostasis via mesenchymal Gαq/11-mediated TGFβ2 activation

  2020cites this paper
• The Prediction of miRNAs in SARS-CoV-2 Genomes: hsa-miR Databases Identify 7 Key miRs Linked to Host Responses and Virus Pathogenicity-Related KEGG Pathways Significant for Comorbidities

  2020cites this paper
• Postnatal morphological lung development of wild type and CD26/DPP4 deficient rat pups in dependency of LPS exposure.

  2020cites this paper
• Recent advances in our understanding of the mechanisms of lung alveolarization and bronchopulmonary dysplasia.

  2019cites this paper
• Parenteral nutrition as a risk factor for bronchopulmonary dysplasia: its role and possible mechanisms in infants less than 29 weeks gestation

  2019cites this paper
• Drugs for the Prevention and Treatment of Bronchopulmonary Dysplasia.

  2019cites this paper
• Developmental pathways in the pathogenesis of lung fibrosis.

  2019cites this paper
• Effect of progesterone on Smad signaling and TGF-β/Smad-regulated genes in lung epithelial cells

  2018cites this paper
• Targeting transglutaminase 2 partially restores extracellular matrix structure but not alveolar architecture in experimental bronchopulmonary dysplasia

  2018cites this paper
• TGF-β Family Signaling in Ductal Differentiation and Branching Morphogenesis.

  2018cites this paper
• Pulmonary vascular development in congenital diaphragmatic hernia

  2018cites this paper
• Circulating microRNAs are associated with Pulmonary Hypertension and Development of Chronic Lung Disease in Congenital Diaphragmatic Hernia

  2018cites this paper
• Molecular mechanisms of intrauterine growth restriction

  2018cites this paper
• Molecular mechanisms of intrauterine growth restriction

  2018cites this paper
• Endothelial cells are not required for specification of respiratory progenitors

  2017cites this paper
• Bone Morphogenetic Protein 9 Protects against Neonatal Hyperoxia-Induced Impairment of Alveolarization and Pulmonary Inflammation

  2017cites this paper
• 62 – Regulation of Alveolarization

  2017cites this paper
• Recent advances in our understanding of the mechanisms of late lung development and bronchopulmonary dysplasia.

  2017cites this paper
• Trinucleotide repeat containing 6c (TNRC6c) is essential for microvascular maturation during distal airspace sacculation in the developing lung

  2017cites this paper
• The Cytokine TGF‐&bgr; Promotes the Development and Homeostasis of Alveolar Macrophages

  2017cites this paper
• Caffeine modulates glucocorticoid-induced expression of CTGF in lung epithelial cells and fibroblasts

  2017cites this paper
• Transforming growth factor-β stimulates Smad1/5 signaling in pulmonary artery smooth muscle cells and fibroblasts of the newborn mouse through ALK1.

  2017cites this paper
• Increased TGF-β: a drawback of tracheal occlusion in human and experimental congenital diaphragmatic hernia?

  2016cites this paper
• Initial Suppression of Transforming Growth Factor-β Signaling and Loss of TGFBI Causes Early Alveolar Structural Defects Resulting in Bronchopulmonary Dysplasia.

  2016cites this paper
• Spatially-Resolved Proteomics: Rapid Quantitative Analysis of Laser Capture Microdissected Alveolar Tissue Samples

  2016cites this paper
• SOX2 in the Development and Maintenance of the Trachea, Lung, and Esophagus

  2016cites this paper
• Approach to Unravel the Molecular Mechanisms Underlying Variations in Lung Function

  2015cites this paper
• Collagen and elastin cross-linking is altered during aberrant late lung development associated with hyperoxia.

  2015cites this paper
• Plasticity of Hopx+ Type I alveolar cells to regenerate Type II cells in the lung

  2015cites this paper
• The H 2 S-generating enzymes cystathionine (cid:2) -synthase and cystathionine (cid:3) lyase play a role in vascular development during normal lung alveolarization

  2015cites this paper
• Molecular mechanisms underlying variations in lung function: a systems genetics analysis.

  2015cites this paper
• Regulatory T Cells Are Critical for Clearing Influenza A Virus in Neonatal Mice

  2015cites this paper
• Pursuing novel molecular mechanisms and treatment strategies to enhance lung growth in neonatal chronic lung disease (CLD)

  2015cites this paper
• Development of the Respiratory System (Including the Preterm Infant)

  2015cites this paper
• BMP signaling controls postnatal muscle development.

  2015cites this paper
• The H2S-generating enzymes cystathionine β-synthase and cystathionine γ-lyase play a role in vascular development during normal lung alveolarization.

  2015cites this paper
• Caffeine and Rolipram Affect Smad Signalling and TGF-β1 Stimulated CTGF and Transgelin Expression in Lung Epithelial Cells

  2014cites this paper
• Acvrl 1 / Smad 1 Axis in Lung Fibroblasts Signaling from the Tgfbr 1 / Smad 2 / 3 Axis to β to Shift Transforming Growth Factor-Glucocorticoids Recruit Tgfbr 3 and Smad 1 Signal Transduction :

  2014cites this paper
• Maternal Deprivation Decelerates Postnatal Morphological Lung Development of F344 Rats

  2014cites this paper
• Transient early wheeze and lung function in early childhood associated with chronic obstructive pulmonary disease genes.

  2014cites this paper
• Smad‐induced alterations of matrix metabolism by a myristoyl tetra peptide

  2014cites this paper
• Prevention of early postnatal hyperalimentation protects against activation of transforming growth factor-β/bone morphogenetic protein and interleukin-6 signaling in rat lungs after intrauterine growth restriction.

  2014cites this paper
• Participación de las metaloproteinasas de matriz extracelular en la EPOC

  2014cites this paper
• Systemic hydrogen sulfide administration partially restores normal alveolarization in an experimental animal model of bronchopulmonary dysplasia.

  2014cites this paper
• Transglutaminase 2: a new player in bronchopulmonary dysplasia?

  2014cites this paper
• Hyperoxia induces alveolar epithelial-to-mesenchymal cell transition.

  2014cites this paper
• Physiopathologie des anomalies du développement alvéolaire dans le RCIU : approche expérimentale et clinique

  2014cites this paper
• Deregulation of the lysyl hydroxylase matrix cross-linking system in experimental and clinical bronchopulmonary dysplasia.

  2014cites this paper
• Recent advances in late lung development and the pathogenesis of bronchopulmonary dysplasia.

  2013cites this paper
• Glucocorticoids Recruit Tgfbr3 and Smad1 to Shift Transforming Growth Factor-β Signaling from the Tgfbr1/Smad2/3 Axis to the Acvrl1/Smad1 Axis in Lung Fibroblasts*

  2013cites this paper
• Perinatal factors in neonatal and pediatric lung diseases

  2013cites this paper
• Extracellular matrix structure and tissue stiffness control postnatal lung development through the lipoprotein receptor-related protein 5/Tie2 signaling system.

  2013cites this paper
• Maternal smoking and the retinoid pathway in the developing lung

  2012cites this paper
• Alveolar Macrophages in Neonatal Mice Are Inherently Unresponsive to Pneumocystis murina Infection

  2012cites this paper
• Developmental nicotine exposure results in programming of alveolar simplification and interstitial pulmonary fibrosis in adult male rats.

  2012cites this paper
• High Throughput Determination of TGFβ1/SMAD3 Targets in A549 Lung Epithelial Cells

  2011cites this paper
• Inhibition of TGF-β Signaling and Decreased Apoptosis in IUGR-Associated Lung Disease in Rats

  2011cites this paper
• The Marfan Syndrome

  2010cites this paper
• Regulation of the pulmonary circulation in the fetus and newborn.

  2010cites this paper
• Palifermin induces alveolar maintenance programs in emphysematous mice.

  2010cites this paper
• Conditional overexpression of connective tissue growth factor disrupts postnatal lung development.

  2010cites this paper
• Gene expression profile of androgen modulated genes in the murine fetal developing lung

  2010cites this paper
• Regulation of the pulmonary vasculature by lysophospholipase D autotaxin - lysophosphatidic acid signaling

  2009cites this paper
• Endoglin as a marker in cervical paragangliomas

  2009cites this paper
• Global and gene-specific translational regulation in rat lung development.

  2009cites this paper
• CGGAAGTTCTAGAATCCAGGATGA GGGCTCATAATCTTTCACTTCTCC Plunc CCTTGGTTGAGCTGAATCGT GTGAGGAGAAGGCAGGCATA Cp GGAGATGAGGTCAACTGGTATGTG CAGAACTATGAATTCCCCTGTGCT IL 18 GAAGGATGTCTACCCTCTCCTGTA CTGGCACACGTTTCTGAAAGA Stat 3

  2009cites this paper
• Endoglin and activin receptor-like-kinase 1 are co-expressed in the distal vessels of the lung: implications for two familial vascular dysplasias, HHT and PAH

  2009cites this paper
• An overview of pulmonary surfactant in the neonate: genetics, metabolism, and the role of surfactant in health and disease.

  2009cites this paper
• Lysyl oxidase activity is dysregulated during impaired alveolarization of mouse and human lungs.

  2009cites this paper
• Loss of Thy-1 inhibits alveolar development in the newborn mouse lung.

  2009cites this paper
• PDGF-Rα gene expression predicts proliferation, but PDGF-A suppresses transdifferentiation of neonatal mouse lung myofibroblasts

  2009cites this paper
• Sox2 Is Required for Maintenance and Differentiation of Bronchiolar Clara, Ciliated, and Goblet Cells

  2009cites this paper
• Regulation of TGF-β signalling by Fbxo11, the gene mutated in the Jeff otitis media mouse mutant

  2009cites this paper
• Transforming growth factor-beta signaling across ages: from distorted lung development to chronic obstructive pulmonary disease.

  2009cites this paper
• Age-dependent endothelial nitric oxide synthase uncoupling in pulmonary arteries of endoglin heterozygous mice.

  2009cites this paper
• Inhibition of phosphodiesterase 4 enhances lung alveolarisation in neonatal mice exposed to hyperoxia

  2009cites this paper
• Systems approach to analyzing the TGFbeta/SMAD3 gene regulatory pathway in A549 cells

  2008cites this paper
• Transforming growth factor-beta signaling mediates hypoxia-induced pulmonary arterial remodeling and inhibition of alveolar development in newborn mouse lung.

  2008cites this paper