Killer toxin of Hanseniaspora uvarum

No abstract is available for this paper.

• Publication year

  2004

• Venue

  Archives of Microbiology

• Publication date

  Unknown publication date

• Fields of study

  Biology, Medicine, Chemistry

• Identifiers
  DOI 10.1007/BF00423329PMID 2206104
• External record

  Open on Semantic Scholar

• Source metadata

  Semantic Scholar, PubMed

• No claims are published for this paper.

• No concepts are published for this paper.

• A comparison of the killer character in different yeasts and its classification

  2004cited by this paper
• Physiological conditions affecting the sensitivity of Saccharomyces cerevisiae to a Pichia kluyveri killer toxin and energy requirement for toxin action

  2004cited by this paper
• Killer toxin producing strains of the yeasts Hanseniaspora uvarum and Pichia kluyveri

  2004cited by this paper
• Purification of yeast killer toxin KT28 by receptor-mediated affinity chromatography

  1989cited by this paper
• Killer Toxins of Yeasts: Inhibitors of Fermentation and Their Adsorption.

  1987cited by this paper
• Mannoprotein of the yeast cell wall as primary receptor for the killer toxin of Saccharomyces cerevisiae strain 28.

  1987cited by this paper
• Double-stranded RNA replication in yeast: the killer system.

  1986cited by this paper
• Killer toxins in new isolates of the yeasts Hanseniaspora uvarum and Pichia kluyveri

  1985cited by this paper
• Double-stranded ribonucleic acid killer systems in yeasts

  1984cited by this paper
• Comparison of the killer toxin of several yeasts and the purification of a toxin of type K2

  1984cited by this paper
• Secretion of Saccharomyces cerevisiae Killer Toxin: Processing of the Glycosylated Precursor

  1983cited by this paper
• ScV “Killer” Viruses in Yeast

  1983cited by this paper
• Physiology of killer factor in yeast.

  1981cited by this paper
• Cleavage of Structural Proteins during the Assembly of the Head of Bacteriophage T4

  1970cited by this paper

• Killer yeast in winemaking: A comprehensive review

  2025cites this paper
• Molecular Basis of Yeasts Antimicrobial Activity—Developing Innovative Strategies for Biomedicine and Biocontrol

  2024cites this paper
• Biology and physiology of hanseniaspora vineae: metabolic diversity and increase flavour complexity for food fermentation.

  2023cites this paper
• Exploring future applications of the apiculate yeast Hanseniaspora

  2023cites this paper
• Purification and characterization of a Metschnikowia pulcherrima killer toxin with antagonistic activity against pathogenic microorganisms

  2022cites this paper
• A natural approach, the use of killer toxin produced by Metschnikowia pulcherrima in fresh ground beef patties for shelf life extention.

  2021cites this paper
• Molecular Tools to Analyze Microbial Populations in Red Wines

  2019cites this paper
• Killer Activity of Hanseniaspora uvarum Isolated from Dates Vinegar: Partially Purification and Characterization of Killer Toxin

  2019cites this paper
• Isolation of Yeasts from Guajillo Pepper (Capsicum annuum L.) Fermentation and Study of Some Probiotic Characteristics

  2019cites this paper
• Enemies with benefits: mutualistic interactions of viruses with lower eukaryotes

  2018cites this paper
• The Biology of Pichia membranifaciens Killer Toxins

  2017cites this paper
• Glycolytic Functions Are Conserved in the Genome of the Wine Yeast Hanseniaspora uvarum, and Pyruvate Kinase Limits Its Capacity for Alcoholic Fermentation

  2017cites this paper
• TCTACCATAGCCAATCAAAG CCAGACTTAGAGCTGATGAC GCTTACAGCACCTAAAGATG GGCTCAAATTTAGCACCATC TTGACATGTTCGAGGTGTTC GATCCCTGCTTTACTTGAC 9 AACTAAGGCAGTATCCAAAG GGTTTAGCAGAATCTTTAGC TGCCTACCTTAAATTCTCAC GCAGCTGATCTATCACTTTG TGGAATAACGGAGTGAATAC GTCATGTTCTTCACCATACC 10 AAATGGCCGAAACCATTGGG CTTGTGTTGTTGCTGAATAC AT

  2017cites this paper
• Genome sequencing and analysis of Kloeckera apiculata strain 34-9, a biocontrol agent against postharvest pathogens in citrus

  2016cites this paper
• Metagenomic Analysis of Fungal Diversity on Strawberry Plants and the Effect of Management Practices on the Fungal Community Structure of Aerial Organs

  2016cites this paper
• Hanseniaspora uvarum from Winemaking Environments Show Spatial and Temporal Genetic Clustering

  2016cites this paper
• Microbial Succession in Spontaneously Fermented Grape Must Before, During and After Stuck Fermentation

  2016cites this paper
• Yeast population dynamics reveal a potential ‘collaboration’ between Metschnikowia pulcherrima and Saccharomyces uvarum for the production of reduced alcohol wines during Shiraz fermentation

  2015cites this paper
• Control of Toxigenic Molds in Food Processing

  2014cites this paper
• 28. Wine Technology

  2012cites this paper
• Yeasts Producing Killer Toxins: An Overview

  2011cites this paper
• Compatibility with Killer Explains the Rise of RNAi-Deficient Fungi

  2011cites this paper
• Yeasts and lactic acid bacteria coffee fermentation starter cultures

  2010cites this paper
• Yeast Killer Toxins: Fundamentals and Applications

  2009cites this paper
• Pichia anomala DBVPG 3003 Secretes a Ubiquitin-Like Protein That Has Antimicrobial Activity

  2008cites this paper
• Isolamento e caracterização de leveduras de uma madeireira e sua correlação com um caso clínico de criptocose

  2007cites this paper
• Isolation and characterization of thermotolearant yeast for ethanol production

  2006cites this paper
• Biocontrol of the Food-Borne Pathogens Listeria monocytogenes and Salmonella enterica Serovar Poona on Fresh-Cut Apples with Naturally Occurring Bacterial and Yeast Antagonists

  2006cites this paper
• Estado actual de los conocimientos científicos sobre los aspectos del vino relacionados con la salud del consumidor

  2005cites this paper
• Isolation and Characterization of the K5-Type Yeast Killer Protein and Its Homology with an Exo-β-1,3-glucanase

  2004cites this paper
• Killer toxin of Pichia membranifaciens and its possible use as a biocontrol agent against grey mould disease of grapevine.

  2004cites this paper
• DO SISTEMA KILLER

  2004cites this paper
• Characterization of the in vitro antimycotic activity of a novel killer protein from Williopsis saturnus DBVPG 4561 against emerging pathogenic yeasts.

  2004cites this paper
• Yeasts as biological agents to control Botrytis cinerea.

  2004cites this paper
• The viral killer system in yeast: from molecular biology to application.

  2002cites this paper
• (1→6)‐β‐D‐glucan as the cell wall binding site for Debaryomyces hansenii killer toxin

  2002cites this paper
• Killer Toxin of Kluyveromyces phaffiiDBVPG 6076 as a Biopreservative Agent To Control Apiculate Wine Yeasts

  2001cites this paper
• Isolation, Purification, and Characterization of a Killer Protein from Schwanniomyces occidentalis

  2000cites this paper
• Differential growth inhibition as a tool to increase the discriminating power of killer toxin sensitivity in fingerprinting of yeasts.

  2000cites this paper
• (1-->6)-beta-D-glucan as cell wall receptor for Pichia membranifaciens killer toxin.

  2000cites this paper
• Unique double-stranded RNAs responsible for the anti-Candida activity of the yeast Hanseniaspora uvarum

  1997cites this paper
• Yeast killer systems

  1997cites this paper
• Killer toxin-secreting double-stranded RNA mycoviruses in the yeasts Hanseniaspora uvarum and Zygosaccharomyces bailii

  1994cites this paper
• Spoilage yeasts.

  1992cites this paper
• Interfaces of the yeast killer phenomenon.

  1991cites this paper
• Passage of molecules through yeast cell walls: A brief essay‐review

  1991cites this paper
• CHARACTERIZATION OF THE SACCHAROMYCES CEREVISIAE Y 500-4 L KILLER TOXIN

  year unknowncites this paper