Flagellar hook structures of Caulobacter and Salmonella and their relationship to filament structure.

No abstract is available for this paper.

• Publication year

  1982

• Venue

  Journal of Molecular Biology

• Publication date

  1982-11-25

• Fields of study

  Biology, Medicine

• Identifiers
  DOI 10.1016/0022-2836(82)90162-0PMID 6759665
• External record

  Open on Semantic Scholar

• Source metadata

  Semantic Scholar, PubMed

• No claims are published for this paper.

• No concepts are published for this paper.

• Micro-video study of moving bacterial flagellar filaments. III. Cyclic transformation induced by mechanical force.

  1982cited by this paper
• Incomplete flagellar structures in Escherichia coli mutants

  1981cited by this paper
• Three-dimensional reconstruction of the flagellar hook from Caulobacter crescentus.

  1981cited by this paper
• Reconstitution in vitro of flagellar filaments onto hook structures attached to bacterial cells.

  1981cited by this paper
• A surveying optical diffractometer

  1981cited by this paper
• Role of the flaR gene in flagellar hook formation in Salmonella spp

  1981cited by this paper
• Determination of the degree of elliptical flattening for helical fibers from tilted view.

  1980cited by this paper
• A new method for determination of parity in optical diffraction patterns from the structures with helical symmetry.

  1980cited by this paper
• In vitro polymerization of polyhook protein from Salmonella SJW880.

  1980cited by this paper
• Transition of bacterial flagella from helical to straight forms with different subunit arrangements.

  1979cited by this paper
• Flagellar hook and basal complex of Caulobacter crescentus

  1979cited by this paper
• Three-dimensional image reconstruction of straight flagella from a mutant Salmonella typhimurium.

  1979cited by this paper
• Bacterial motility and chemotaxis: the molecular biology of a behavioral system.

  1978cited by this paper
• Change of waveform in bacterial flagella : the role of mechanics at the molecular level

  1978cited by this paper
• Normal-to-curly flagellar transitions and their role in bacterial tumbling. Stabilization of an alternative quaternary structure by mechanical force.

  1977cited by this paper
• Bacterial flagella rotating in bundles: a study in helical geometry.

  1977cited by this paper
• Three-dimensional image reconstructions of the contractile tail of T4 bacteriophage.

  1975cited by this paper
• Structure of straight flagellar filaments from a mutant of Escherichia coli.

  1975cited by this paper
• A new fla gene in Salmonella typhimurium—flaR—and its mutant phenotype-superhooks

  1973cited by this paper
• Bacteria Swim by Rotating their Flagellar Filaments

  1973cited by this paper
• A model of bacterial flagella based on small-angle x-ray scattering and hydrodynamic data which indicated an elongated shape of the flagellin protomer.

  1972cited by this paper
• Flagellar Assembly Mutants in Escherichia coli

  1972cited by this paper
• The hand of the helix of tobacco virus.

  1972cited by this paper
• Structure of straight flagella from a mutant Salmonella.

  1972cited by this paper
• The hand of the helix of tobacco mosaic virus

  1972cited by this paper
• Fine Structure and Isolation of the Hook-Basal Body Complex of Flagella from Escherichia coli and Bacillus subtilis

  1971cited by this paper
• Bacterial Flagella: Polarity of Elongation

  1970cited by this paper
• Polymerization of flagellin and polymorphism of flagella.

  1970cited by this paper
• Reconstruction of three-dimensional images from electron micrographs of structures with helical symmetry.

  1970cited by this paper
• Tropomyosin: crystal structure, polymorphism and molecular interactions.

  1969cited by this paper
• Polarity of flagellar growth in salmonella.

  1969cited by this paper
• Structure of the sheath of bacteriophage T4. I. Structure of the contracted sheath and polysheath.

  1967cited by this paper
• Use of uranyl formate as a negative stain.

  1965cited by this paper
• RESOLUTION OF THE SUBSTRUCTURE OF TOBACCO MOSAIC VIRUS IN THE ELECTRON MICROSCOPE.

  1964cited by this paper
• Diffraction by helical structures

  1958cited by this paper

• Crystal structure of a 20kDa fragment of FlgG

  2019cites this paper
• Architecture of the Bacterial Flagellar Distal Rod and Hook of Salmonella

  2019cites this paper
• Characterization of FlgP, an Essential Protein for Flagellar Assembly in Rhodobacter sphaeroides

  2018cites this paper
• Bacterial flagellar axial structure and its construction

  2018cites this paper
• Molecular dynamics simulation of bacterial flagella

  2017cites this paper
• An intrinsically disordered linker controlling the formation and the stability of the bacterial flagellar hook

  2017cites this paper
• Structural insights into bacterial flagellar hooks similarities and specificities

  2016cites this paper
• Complete structure of the bacterial flagellar hook reveals extensive set of stabilizing interactions

  2016cites this paper
• 15 Bacterial Behavior

  2013cites this paper
• Flagellar Hook Flexibility Is Essential for Bundle Formation in Swimming Escherichia coli Cells

  2012cites this paper
• TTGCATCAATACTGGACTC TTGAATTTTCAGATCCCTC AAGCTTTAATACCCGAGCTTCAAG AAGÇTTTCAAGTCAGCGTAATGCT TATCAGAGGTAGTTGGCGTC TGTCTAGCTTCAAGTATGACG CATATGGAAACCAAAATTAATTCAC CTGCAGTTATTTACTTTTTTGTAATTG GGATCCTAATACCCGAGCTTCAAG CATATGACCTCCCTCATTTAAAATTGC ACCCAATATCCTAAAACTTC TGGCAGCTGTATAAATTCCT ACATCTGGCAAAGCACAA

  2012cites this paper
• A Single-Domain FlgJ Contributes to Flagellar Hook and Filament Formation in the Lyme Disease Spirochete Borrelia burgdorferi

  2011cites this paper
• Gap compression/extension mechanism of bacterial flagellar hook as the molecular universal joint.

  2007cites this paper
• Variation in bacterial flagellins: from sequence to structure.

  2006cites this paper
• A partial atomic structure for the flagellar hook of Salmonella typhimurium.

  2005cites this paper
• Structure of the bacterial flagellar hook and implication for the molecular universal joint mechanism

  2004cites this paper
• Structure of the rotor of the bacterial flagellar motor revealed by electron cryomicroscopy and single-particle image analysis.

  2004cites this paper
• In vitro characterization of FlgB, FlgC, FlgF, FlgG, and FliE, flagellar basal body proteins of Salmonella.

  2004cites this paper
• Protein secretion and the pathogenesis of bacterial infections.

  2001cites this paper
• Flagellar determinants of bacterial sensitivity to chi-phage.

  1999cites this paper
• The bacterial flagella motor.

  1999cites this paper
• Kinetic analysis of the growth rate of the flagellar hook in Salmonella typhimurium by the population balance method.

  1998cites this paper
• Flagellar filament elongation can be impaired by mutations in the hook protein FlgE of Salmonella typhimurium: a possible role of the hook as a passage for the anti‐sigma factor FlgM

  1998cites this paper
• Structural and genetic analysis of a mutant of Rhodobacter sphaeroides WS8 deficient in hook length control

  1997cites this paper
• Molecular architecture of bacterial flagellum

  1997cites this paper
• Molecular Approaches in Attempts to Identify the Flagellin b-type Gene in Clone pKW52

  1996cites this paper
• Characterization of the flagellar hook length control protein fliK of Salmonella typhimurium and Escherichia coli

  1996cites this paper
• Structural organization and assembly of flagellar hook protein from Salmonella typhimurium.

  1995cites this paper
• Molecular characterisation of flagellar genes from agrobacterium tumefaciens

  1994cites this paper
• A mutant hook-associated protein (HAP3) facilitates torsionally induced transformations of the flagellar filament of Escherichia coli.

  1994cites this paper
• Roles of FliK and FlhB in determination of flagellar hook length in Salmonella typhimurium

  1994cites this paper
• Sensing structural intermediates in bacterial flagellar assembly by export of a negative regulator.

  1993cites this paper
• The bacterial flagellar motor.

  1993cites this paper
• Domain organization of the subunit of the Salmonella typhimurium flagellar hook.

  1993cites this paper
• Size of the export channel in the flagellar filament of Salmonella typhimurium.

  1993cites this paper
• Biochemical and antigenic properties of the Campylobacter flagellar hook protein

  1992cites this paper
• Bacterial motility and chemotaxis.

  1992cites this paper
• Terminal disorder: a common structural feature of the axial proteins of bacterial flagellum?

  1992cites this paper
• The rigidity of bacterial flagellar filaments and its relation to filament polymorphism.

  1992cites this paper
• Genetics and biogenesis of bacterial flagella.

  1992cites this paper
• A three-start helical sheath on the flagellar filament of Caulobacter crescentus

  1992cites this paper
• Bacterial motility and chemotaxis.

  1992cites this paper
• Mass determination and estimation of subunit stoichiometry of the bacterial hook-basal body flagellar complex of Salmonella typhimurium by scanning transmission electron microscopy.

  1992cites this paper
• Behavioral responses in bacteria.

  1992cites this paper
• Genetic analysis of the bacterial flagellum.

  1991cites this paper
• Compliance of bacterial polyhooks measured with optical tweezers.

  1991cites this paper
• New structural features of the flagellar base in Salmonella typhimurium revealed by rapid-freeze electron microscopy

  1991cites this paper
• The bacterial flagellum and flagellar motor: structure, assembly and function.

  1991cites this paper
• CHAPTER 11 – Motility

  1990cites this paper
• Flagellar hook and hook-associated proteins of Salmonella typhimurium and their relationship to other axial components of the flagellum.

  1990cites this paper
• Stoichiometric analysis of the flagellar hook-(basal-body) complex of Salmonella typhimurium.

  1990cites this paper
• FlgB, FlgC, FlgF and FlgG. A family of structurally related proteins in the flagellar basal body of Salmonella typhimurium.

  1990cites this paper
• Bacterial flagellar structure and function.

  1988cites this paper
• Overproduction of the MotA protein of Escherichia coli and estimation of its wild-type level

  1988cites this paper
• Localization and stoichiometry of hook-associated proteins within Salmonella typhimurium flagella

  1987cites this paper
• Identification of a gene cluster involved in flagellar basal body biogenesis in Caulobacter crescentus.

  1987cites this paper
• Three-dimensional structure of the frozen-hydrated flagellar filament. The left-handed filament of Salmonella typhimurium.

  1987cites this paper
• The covalent structure of four salmonellar flagellar filament proteins

  1986cites this paper
• A plausible mechanism for flagellar rotation in bacteria

  1986cites this paper
• Locations of hook-associated proteins in flagellar structures of Salmonella typhimurium

  1985cites this paper
• Generation of polarity during Caulobacter cell differentiation.

  1985cites this paper
• Purification and characterization of the flagellar hook-basal body complex of Salmonella typhimurium

  1985cites this paper
• Constraints on flagellar rotation.

  1985cites this paper
• Electron microscopic observations of structures associated with the flagella of Spirillum volutans

  1985cites this paper
• Polymorphic transition of the flagellar polyhook from Escherichia coli and Salmonella typhimurium.

  1984cites this paper
• Bacterial motility and the bacterial flagellar motor.

  1984cites this paper
• Methylation involved in chemotaxis is regulated during Caulobacter differentiation.

  1983cites this paper
• Electron Microscopic Observations of Structures Associated with the Flagella of Spirillum volultans

  year unknowncites this paper