Stanniocalcin gene expression during mouse urogenital development: A possible role in mesenchymal‐epithelial signalling

No abstract is available for this paper.

• Publication year

  2001

• Venue

  Developmental Dynamics

• Publication date

  Unknown publication date

• Fields of study

  Biology, Medicine

• Identifiers
  DOI 10.1002/1097-0177(2000)9999:9999<::AID-DVDY1086>3.0.CO;2-5PMID 11146507
• External record

  Open on Semantic Scholar

• Source metadata

  Semantic Scholar, PubMed

• No claims are published for this paper.

• No concepts are published for this paper.

• Dynamic changes in stanniocalcin gene expression in the mouse uterus during early implantation.

  2001cited by this paper
• Stanniocalcin: A molecular guard of neurons during cerebral ischemia.

  2000cited by this paper
• Development of a human stanniocalcin radioimmunoassay: serum and tissue hormone levels and pharmacokinetics in the rat.

  2000cited by this paper
• The distribution of stanniocalcin 1 protein in fetal mouse tissues suggests a role in bone and muscle development.

  2000cited by this paper
• Dynamic regulation of mouse ovarian stanniocalcin expression during gestation and lactation.

  2000cited by this paper
• FGF-7 modulates ureteric bud growth and nephron number in the developing kidney.

  1999cited by this paper
• Development and differentiation of the interstitial and tubular compartments of fetal porcine testes.

  1999cited by this paper
• Expression of 3beta-hydroxysteroid dehydrogenase type I and type VI isoforms in the mouse testis during development.

  1999cited by this paper
• Dominant effects of RET receptor misexpression and ligand-independent RET signaling on ureteric bud development.

  1999cited by this paper
• GDNF and its receptors in the regulation of the ureteric branching.

  1999cited by this paper
• Expression, purification, and bioassay of human stanniocalcin from baculovirus-infected insect cells and recombinant CHO cells.

  1998cited by this paper
• High expression of stanniocalcin in differentiated brain neurons.

  1998cited by this paper
• The co-localization of stanniocalcin protein, mRNA and kidney cell markers in the rat kidney.

  1998cited by this paper
• Stanniocalcin: a novel protein regulating calcium and phosphate transport across mammalian intestine.

  1998cited by this paper
• In situ hybridization analysis of stanniocalcin mRNA expressing cells in the mouse kidney.

  1998cited by this paper
• Stanniocalcin: a novel protein regulating calcium and phosphate transport across mammalian intestine.

  1998cited by this paper
• Comparative Analysis of Mammalian Stanniocalcin Genes* *This work was supported by grants from London Health Sciences Research, Inc. (to G.E.D.), the London Regional Cancer Center (to G.E.D.), and the Medical Research Council of Canada (to G.F.W.).

  1998cited by this paper
• Comparative analysis of mammalian stanniocalcin genes.

  1998cited by this paper
• Inductive tissue interactions, cell signaling, and the control of kidney organogenesis.

  1997cited by this paper
• Emx2 developmental expression in the primordia of the reproductive and excretory systems

  1997cited by this paper
• Human Stanniocalcin Inhibits Renal Phosphate Excretion in the Rat

  1997cited by this paper
• Essential role of stromal mesenchyme in kidney morphogenesis revealed by targeted disruption of Winged Helix transcription factor BF-2.

  1996cited by this paper
• Immunocytochemical localization of stanniocalcin cells in the rat kidney.

  1996cited by this paper
• A ureteric bud cell line induces nephrogenesis in two steps by two distinct signals.

  1996cited by this paper
• Human stanniocalcin: a possible hormonal regulator of mineral metabolism.

  1996cited by this paper
• Embryonic expression of glial cell-line derived neurotrophic factor (GDNF) suggests multiple developmental roles in neural differentiation and epithelial-mesenchymal interactions.

  1996cited by this paper
• Development of urinary concentrating capacity: role of aquaporin-2.

  1996cited by this paper
• Molecular cloning and characterization of mouse stanniocalcin cDNA

  1996cited by this paper
• Immunological and biological evidence for a stanniocalcin-like hormone in human kidney.

  1995cited by this paper
• Pattern of keratinocyte growth factor and keratinocyte growth factor receptor expression during mouse fetal development suggests a role in mediating morphogenetic mesenchymal‐epithelial interactions

  1995cited by this paper
• A novel human cDNA highly homologous to the fish hormone stanniocalcin.

  1995cited by this paper
• 9 The Molecular Biology of the Corpuscles of Stannius and Regulation of Stanniocalcin Gene Expression

  1994cited by this paper
• Expression of activin subunits, activin receptors and follistatin in postimplantation mouse embryos suggests specific developmental functions for different activins.

  1994cited by this paper
• Ontogeny of expression of the genes for steroidogenic enzymes P450 side-chain cleavage, 3 beta-hydroxysteroid dehydrogenase, P450 17 alpha-hydroxylase/C17-20 lyase, and P450 aromatase in fetal mouse gonads.

  1994cited by this paper
• Leydig cells: endocrine, paracrine, and autocrine regulation.

  1994cited by this paper
• Abundance of Na(+)-K(+)-ATPase mRNA is regulated by glucocorticoid hormones in infant rat kidneys.

  1991cited by this paper
• Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction.

  1987cited by this paper
• Purification, characterization, and bioassay of teleocalcin, a glycoprotein from salmon corpuscles of Stannius.

  1986cited by this paper
• Cytophysiology of corpuscles of Stannius.

  1976cited by this paper
• The development and phylogeny of the corpuscle of stannius in ganoid and teleostean fishes

  1942cited by this paper

• Stanniocalcin Protein Expression in Female Reproductive Organs: Literature Review and Public Cancer Database Analysis

  2024cites this paper
• Prostate cancer research: tools, cell types, and molecular targets

  2024cites this paper
• The opposing action of stromal cell proenkephalin and stem cell transcription factors in prostate cancer differentiation

  2021cites this paper
• Prostate cancer reprogramming and dedifferentiation into induced pluripotent stem cells

  2021cites this paper
• New Insights Into Physiological and Pathophysiological Functions of Stanniocalcin 2

  2020cites this paper
• Effects of miR-101-3p on goat granulosa cells in vitro and ovarian development in vivo via STC1

  2020cites this paper
• Comparative analysis of transcriptomes between apical pulp‐derived cells from deciduous teeth and permanent teeth or dental pulp cells from exfoliated deciduous teeth

  2019cites this paper
• Role of stanniocalcin-1 in breast cancer

  2019cites this paper
• 150 – Differentiation of the Ovary

  2017cites this paper
• Transcriptional regulation of 5′-flanking regions of stanniocalcin genes by estrogen receptor and estrogen receptor-related receptor

  2016cites this paper
• The proteolytic activity of pregnancy-associated plasma protein-A is potentially regulated by stanniocalcin-1 and -2 during human ovarian follicle development.

  2016cites this paper
• STC-1 expression is upregulated through an Akt/NF-κB-dependent pathway in triple-negative breast cancer cells.

  2016cites this paper
• High expression of STC 1 is associated with poor prognosis of breast cancer patients

  2016cites this paper
• RIS 1 GTAAGCCCATTGAGTCCACGC TCACTTGGTCGCCACCCCCGA ChGn TGCAGCAGTGCCTTTCGATAG GTCGAAATAAGATGAGCCGTTTGA TNC CAGACATCACTGAAAATTCGGCTAC GCAAAGATTCTCAGTGTGTATTCCG EDNRB GCAAACCGCAGAGATAATGACG TCAAGATATTGGGACCGTTTCG STC 2 CAAGTCATTCATCAAAGACGCCTT CCTTTCATTTCACCTCCGGATATC BF ACTCCATGGTCTTTGGCCCAG AGTGGATTG

  2015cites this paper
• Stanniocalcin 1 effects on the renal gluconeogenesis pathway in rat and fish.

  2015cites this paper
• Running Title: Effects of genistein and DEHP on Male Reproduction

  2014cites this paper
• Disruption of Rat Testis Development Following Combined In Utero Exposure to the Phytoestrogen Genistein and Antiandrogenic Plasticizer Di-(2-Ethylhexyl) Phthalate1

  2014cites this paper
• A comparative profile of the microRNA transcriptome in immature and mature porcine testes using Solexa deep sequencing

  2012cites this paper
• Evolution and roles of stanniocalcin.

  2012cites this paper
• Stanniocalcin Supports the Functional Adaptation of Adult-Sized Kidneys Transplanted Into the Pediatric Recipients

  2012cites this paper
• Identification of stromally expressed molecules in the prostate by tag-profiling of cancer-associated fibroblasts, normal fibroblasts and fetal prostate

  2011cites this paper
• Clinical Significance of STC 1 Gene Expression in Patients with Colorectal Cancer

  2011cites this paper
• Clinical significance of STC1 gene expression in patients with colorectal cancer.

  2011cites this paper
• Identification and characterization of the hypoxia-responsive element in human stanniocalcin-1 gene

  2010cites this paper
• Expression and localization of stanniocalcin 1 in swine ovary.

  2010cites this paper
• Immunopathology and Infectious Diseases Anti-Inflammatory and Renal Protective Actions of Stanniocalcin-1 in a Model of Anti-Glomerular Basement Membrane Glomerulonephritis

  2010cites this paper
• Stanniocalcin‐1 suppresses superoxide generation in macrophages through induction of mitochondrial UCP2

  2009cites this paper
• Effects of stanniocalcin 1 on calcium uptake in zebrafish (Danio rerio) embryo.

  2009cites this paper
• Reproductive toxicity and pharmacokinetics of di-n-butyl phthalate (DBP) following dietary exposure of pregnant rats.

  2009cites this paper
• Stanniocalcin-1 secretion and receptor regulation in kidney cells.

  2008cites this paper
• Effects of dexamethasone and dibutyryl cAMP on stanniocalcin-1 mRNA expression in rat primary Sertoli and Leydig cells.

  2008cites this paper
• Stanniocalcin-1 Suppresses Superoxide Generation in Macrophages through Induction of Mitochondrial Ucp2

  2008cites this paper
• Fetal mouse phthalate exposure shows that Gonocyte multinucleation is not associated with decreased testicular testosterone.

  2007cites this paper
• The stanniocalcin family of proteins.

  2006cites this paper
• Expression and regulation of stanniocalcin 1 and 2 in rat uterus during embryo implantation and decidualization.

  2006cites this paper
• Avian stanniocalcin-2 is expressed in developing striated muscle and joints

  2006influential citation
• Stanniocalcin: no longer just a fish tale.

  2005cites this paper
• Stanniocalcin in the euryhaline flounder (Platichthys flesus): primary structure, tissue distribution, and response to altered salinity.

  2005cites this paper
• Stromal mesenchyme cell genes of the human prostate and bladder

  2005cites this paper
• Nuclear targeting of stanniocalcin to mammary gland alveolar cells during pregnancy and lactation.

  2005cites this paper
• Characterization of big stanniocalcin variants in mammalian adipocytes and adrenocortical cells.

  2005cites this paper
• Evidence for stanniocalcin binding activity in mammalian blood and glomerular filtrate.

  2005cites this paper
• Evidence for stanniocalcin and a related receptor in annelids.

  2004cites this paper
• Temporal and Spatial Expressions of Stanniocalcin mRNA in Mouse Brains

  2004cites this paper
• Stanniocalcin 1 as a pleiotropic factor in mammals.

  2004cites this paper
• Identification of signal transduction pathways that modulate dibutyryl cyclic adenosine monophosphate activation of stanniocalcin gene expression in neuroblastoma cells.

  2003cites this paper
• Targeting of Big Stanniocalcin and Its Receptor to Lipid Storage Droplets of Ovarian Steroidogenic Cells*

  2003cites this paper
• Identification of human SEP1 as a glial cell line-derived neurotrophic factor-inducible protein and its expression in the nervous system.

  2003cites this paper
• Mammalian stanniocalcins and cancer.

  2003influential citation
• Gene expression in epithelial ovarian carcinoma

  2002cites this paper
• Characterization of gene expression induced by RET with MEN2A or MEN2B mutation.

  2002cites this paper
• Stanniocalcin 1 (STC1) Protein and mRNA Are Developmentally Regulated During Embryonic Mouse Osteogenesis: the Potential of STC1 as an Autocrine/Paracrine Factor for Osteoblast Development and Bone Formation

  2002cites this paper
• Stanniocalcin 1 alters muscle and bone structure and function in transgenic mice.

  2002cites this paper
• Overexpression of human stanniocalcin affects growth and reproduction in transgenic mice.

  2002cites this paper
• Advances in Brief Stanniocalcin 2 Is an Estrogen-responsive Gene Coexpressed with the Estrogen Receptor in Human Breast Cancer 1

  2002cites this paper
• Characterization of Mammalian Stanniocalcin Receptors

  2002cites this paper
• Stanniocalcin 2 is an estrogen-responsive gene coexpressed with the estrogen receptor in human breast cancer.

  2002cites this paper
• Prospect of a stanniocalcin endocrine/paracrine system in mammals.

  2002influential citation
• Ovarian stanniocalcin is structurally unique in mammals and its production and release are regulated through the luteinizing hormone receptor.

  2002cites this paper
• Novel expression of the stanniocalcin gene in fish.

  2001cites this paper
• Dynamic changes in stanniocalcin gene expression in the mouse uterus during early implantation.

  2001cites this paper
• cAMP signaling can antagonize potent glucocorticoid post-transcriptional inhibition of stanniocalcin gene expression.

  2001cites this paper
• Possible roles for stanniocalcin during early skeletal patterning and joint formation in the mouse.

  2001influential citation
• Post-natal ontogeny of stanniocalcin gene expression in rodent kidney and regulation by dietary calcium and phosphate.

  2001cites this paper