The human/mouse imprinted genesIGF2, H19, SNRPN andZNF127 map to two conserved autosomal clusters in a marsupial

No abstract is available for this paper.

• Publication year

  1996

• Venue

  Chromosome Research

• Publication date

  1996-06-01

• Fields of study

  Biology, Medicine

• Identifiers
  DOI 10.1007/BF02263680PMID 8817070
• External record

  Open on Semantic Scholar

• Source metadata

  Semantic Scholar, PubMed

• No claims are published for this paper.

• No concepts are published for this paper.

• Cytologic evidence for three human X-chromosomal segments escaping inactivation

  2004cited by this paper
• ANT3 and STS are autosomal in prosimian lemurs: implications for the evolution of the pseudoautosomal region

  2004cited by this paper
• Rapid isolation of recombinant lambda phage DNA for use in fluorescence in situ hybridization

  1996cited by this paper
• Comparative mapping ofSRY in the great apes

  1993cited by this paper
• Evaluation of potential models for imprinted and nonimprinted components of human chromosome 15q11-q13 syndromes by fine-structure homology mapping in the mouse.

  1993cited by this paper
• Comparative mapping of SRY in the great apes.

  1993cited by this paper
• A complete YAC contig of the Prader-Willi/Angelman chromosome region (15q11-q13) and refined localization of the SNRPN gene.

  1993cited by this paper
• Genomic imprinting and candidate genes in the Prader-Willi and Angelman syndromes.

  1993cited by this paper
• Maternal imprinting of the mouse Snrpn gene and conserved linkage homology with the human Prader–Willi syndrome region

  1992cited by this paper
• Physical linkage of two mammalian imprinted genes, H19 and insulin–like growth factor 2

  1992cited by this paper
• The evolution of human chromosome 21: evidence from in situ hybridization in marsupials and a monotreme.

  1992cited by this paper
• Parental imprinting of the mouse insulin-like growth factor II gene.

  1991cited by this paper
• Parental imprinting of the mouse H19 gene

  1991cited by this paper
• Genomic imprinting in mammalian development: a parental tug-of-war.

  1991cited by this paper
• Gene mapping in marsupials: detection of an ancient autosomal gene cluster.

  1991cited by this paper
• Uniparental paternal disomy in a genetic cancer-predisposing syndrome

  1991cited by this paper
• Globin Macromolecular Sequences in Marsupials and Monotremes

  1989cited by this paper
• A fine-structure deletion map of human chromosome 11p: Analysis of J1 series hybrids

  1989cited by this paper
• Delineation of individual human chromosomes in metaphase and interphase cells by in situ suppression hybridization using recombinant DNA libraries

  1988cited by this paper
• Preferential inactivation of the paternally derived X chromosome in the extraembryonic membranes of the mouse

  1975cited by this paper
• Late DNA Replication in the Paternally Derived X Chromosome of Female Kangaroos

  1971cited by this paper
• Directed Genetic Change Model for X Chromosome Inactivation in Eutherian Mammals

  1971cited by this paper
• Phosphoglycerate kinase polymorphism in kangaroos provides further evidence for paternal X inactivation.

  1971cited by this paper

• Reconstruction of the ancestral marsupial karyotype from comparative gene maps

  2013cites this paper
• The mammary gland-specific marsupial ELP and eutherian CTI share a common ancestral gene

  2012cites this paper
• The Imprinted Phlda2 Gene Regulates Extraembryonic Energy Stores

  2009cites this paper
• Characterization of the tammar wallaby (Macropus eugenii) whey acidic protein gene; new insights into the function of the protein

  2009cites this paper
• Mapping the distribution of the telomeric sequence (T2AG3)n in the Macropodoidea (Marsupialia) by fluorescence in situ hybridization. II. The ancestral 2n = 22 macropodid karyotype

  2007cites this paper
• Sex determination in platypus and echidna: autosomal location of SOX3 confirms the absence of SRY from monotremes

  2007cites this paper
• Primer Sequences AATTAACCGTTTTGGTCCT GCGACACACACTTCCC GCCAGTGATGCTAAAGGTTG AACATACGTGGCTCTATGCA AAAGAGAC CTGCTAACAC CCTATGTTGGAGATGTTTAT GTCACCCAAAAGTCATGAGG TGTACCCG CATGCTATACAA GATCGTGCCACTGTACC CGCGTGTCTAACCTCATGGC GGGTTGGTTGTAAATTAAAAC TGTCAAATACTTAAGCACAG CATGTTGCCAAACACAGACC ATCCTGGCAAGACAGTT

  2007cites this paper
• Physical mapping of the IGF2 locus in the South American opossum Monodelphis domestica

  2007cites this paper
• Characterization of two whey protein genes in the Australian dasyurid marsupial, the stripe-faced dunnart (Sminthopsis macroura)

  2006cites this paper
• Sequencing and mapping hemoglobin gene clusters in the Australian model dasyurid marsupial Sminthopsis macroura

  2005cites this paper
• BREAK THE RULES : Genetics of Marsupials and Monotremes

  2005cites this paper
• Chicken orthologues of mammalian imprinted genes are clustered on macrochromosomes and replicate asynchronously.

  2005cites this paper
• Genomic Imprinting in Development and Evolution

  2004cites this paper
• Mapping the Distribution of the Telomeric Sequence (T2AG3)n in the 2n = 14 Ancestral Marsupial Complement and in the Macropodines (Marsupialia: Macropodidae) by fluorescence in situ hybridization

  2004cites this paper
• A centromere-specific retroviral element associated with breaks of synteny in macropodine marsupials

  2004cites this paper
• Potential significance of genomic imprinting defects for reproduction and assisted reproductive technology.

  2004cites this paper
• Animal Cytogenetics and Comparative Mapping

  2004cites this paper
• Comparative Chromosome Painting Between Marsupial Orders: Relationships with a 2n = 14 Ancestral Marsupial Karyotype

  2004cites this paper
• Mapping the distribution of the telomeric sequence (T(2)AG(3))(n) in rock wallabies, Petrogale (Marsupialia: Macropodidae), by fluorescence in situ hybridization. ii. the lateralis complex.

  2002cites this paper
• The sheep (Ovis aries) H19 gene: genomic structure and expression patterns, from the preimplantation embryo to adulthood.

  2002cites this paper
• Chromosome heterozygosity and de novo chromosome rearrangements in mammalian interspecies hybrids

  2001cites this paper
• The minimal mammalian Y chromosome – the marsupial Y as a model system

  2001cites this paper
• The human Y chromosome derives largely from a single autosomal region added to the sex chromosomes 80–130 million years ago

  2001cites this paper
• The ancient source of a distinct gene family encoding proteins featuring RING and C(3)H zinc-finger motifs with abundant expression in developing brain and nervous system.

  2000cites this paper
• Chromosome evolution in kangaroos (Marsupialia: Macropodidae): cross species chromosome painting between the tammar wallaby and rock wallaby spp. with the 2n = 22 ancestral macropodid karyotype.

  1999cites this paper
• Basics of gametic imprinting.

  1999cites this paper
• Genetic conflicts and the evolutionary origin of genomic imprinting.

  1999cites this paper
• A catalogue of imprinted genes and parent-of-origin effects in humans and animals.

  1998cites this paper
• Genomic imprinting, development and disease--is pre-eclampsia caused by a maternally imprinted gene?

  1998cites this paper
• CSF2RA, ANT3, and STS are autosomal in marsupials: implications for the origin of the pseudoautosomal region of mammalian sex chromosomes

  1998cites this paper
• Mapping the Distribution of the Telomeric Sequence (T2AG3)n in the Macropodoidea (Marsupialia), by Fluorescence In Situ Hybridization. I. The Swamp Wallaby, Wallabia Bicolor

  1998influential citation
• Gene Maps of Marsupials.

  1998cites this paper
• Undermethylation associated with retroelement activation and chromosome remodelling in an interspecific mammalian hybrid

  1998cites this paper
• The candidate sex-reversing DAX1 gene is autosomal in marsupials: implications for the evolution of sex determination in mammals.

  1997cites this paper
• Comparative chromosome painting between two marsupials: origins of an XX/XY1Y2 sex chromosome system

  1997cites this paper
• A human candidate spermatogenesis gene, RBM1, is conserved and amplified on the marsupial Y chromosome

  1997cites this paper
• Shared synteny between human chromosome 10 and chromosome 1 of the marsupial tammar wallaby, Macropus eugenii.

  1997cites this paper
• Shared DNA sequences between the X and Y chromosomes in the tammar wallaby – evidence for independent additions to eutherian and marsupial sex chromosomes

  1997cites this paper
• Genes Located In and Near the Human Pseudoautosomal Region are Located in the X-Y Pairing Region in Dog and Sheep

  1997cites this paper
• Potential significance of genomic imprinting defects for reproduction and assisted reproductive technology

  year unknowncites this paper
• Bmc Evolutionary Biology the Evolution of Imprinting: Chromosomal Mapping of Orthologues of Mammalian Imprinted Domains in Monotreme and Marsupial Mammals

  year unknowncites this paper