Cloning and sequencing of the kedarcidin biosynthetic gene cluster from Streptoalloteichus sp. ATCC 53650 revealing new insights into biosynthesis of the enediyne family of antitumor antibiotics.

No abstract is available for this paper.

• Publication year

  2013

• Venue

  Molecular Biosystems

• Publication date

  2013-02-04

• Fields of study

  Biology, Medicine, Chemistry

• Identifiers
  DOI 10.1039/c3mb25523aPMID 23360970PMCID PMC3711097
• External record

  Open on Semantic Scholar

• Source metadata

  Semantic Scholar, PubMed

• No claims are published for this paper.

• No concepts are published for this paper.

• 4-methylideneimidazole-5-one-containing aminomutases in enediyne biosynthesis.

  2012cited by this paper
• Tailoring enzymes acting on carrier protein-tethered substrates in natural product biosynthesis.

  2012cited by this paper
• Specificity of the ester bond forming condensation enzyme SgcC5 in C-1027 biosynthesis.

  2012cited by this paper
• Influence of apoproteins for enediyne production

  2011cited by this paper
• Fijiolides A and B, inhibitors of TNF-alpha-induced NFkappaB activation, from a marine-derived sediment bacterium of the genus Nocardiopsis.

  2010cited by this paper
• Complexity and simplicity in the biosynthesis of enediyne natural products.

  2010cited by this paper
• Polyketide synthase chemistry does not direct biosynthetic divergence between 9- and 10-membered enediynes

  2010cited by this paper
• Characterization of the epoxide hydrolase NcsF2 from the neocarzinostatin biosynthetic gene cluster.

  2010cited by this paper
• Enediyne antitumor antibiotic maduropeptin biosynthesis featuring a C-methyltransferase that acts on a CoA-tethered aromatic substrate.

  2010cited by this paper
• Molecular basis of substrate promiscuity for the SAM-dependent O-methyltransferase NcsB1, involved in the biosynthesis of the enediyne antitumor antibiotic neocarzinostatin.

  2009cited by this paper
• Unusual chemistry in the biosynthesis of the antibiotic chondrochlorens.

  2009cited by this paper
• Characterization of the SgcF epoxide hydrolase supporting an (R)-vicinal diol intermediate for enediyne antitumor antibiotic C-1027 biosynthesis.

  2009cited by this paper
• Iterative type I polyketide synthases for enediyne core biosynthesis.

  2009cited by this paper
• Characterization of SgcE6, the flavin reductase component supporting FAD-dependent halogenation and hydroxylation in the biosynthesis of the enediyne antitumor antibiotic C-1027.

  2009cited by this paper
• Total synthesis of a protected aglycon of the kedarcidin chromophore.

  2009cited by this paper
• C-1027, a radiomimetic enediyne anticancer drug, preferentially targets hypoxic cells.

  2009cited by this paper
• Polyketide-chain branching by an enzymatic Michael addition.

  2009cited by this paper
• A free-standing condensation enzyme catalyzing ester bond formation in C-1027 biosynthesis

  2009cited by this paper
• Natural-product sugar biosynthesis and enzymatic glycodiversification.

  2008cited by this paper
• Regiospecific O-Methylation of Naphthoic Acids Catalyzed by NcsB1, an O-Methyltransferase Involved in the Biosynthesis of the Enediyne Antitumor Antibiotic Neocarzinostatin*

  2008cited by this paper
• The biosynthetic genes encoding for the production of the dynemicin enediyne core in Micromonospora chersina ATCC53710.

  2008cited by this paper
• InterPro: the integrative protein signature database

  2008cited by this paper
• Biosynthesis of enediyne antitumor antibiotics.

  2008cited by this paper
• Unraveling the biosynthesis of the sporolide cyclohexenone building block.

  2008cited by this paper
• A phosphopantetheinylating polyketide synthase producing a linear polyene to initiate enediyne antitumor antibiotic biosynthesis

  2008cited by this paper
• Characterization of the two-component, FAD-dependent monooxygenase SgcC that requires carrier protein-tethered substrates for the biosynthesis of the enediyne antitumor antibiotic C-1027.

  2008cited by this paper
• Design and characterization of mechanism-based inhibitors for the tyrosine aminomutase SgTAM.

  2008cited by this paper
• Biosynthesis of the enediyne antitumor antibiotic C-1027 involves a new branching point in chorismate metabolism

  2008cited by this paper
• Characterization of NcsB2 as a promiscuous naphthoic acid/coenzyme A ligase integral to the biosynthesis of the enediyne antitumor antibiotic neocarzinostatin.

  2007cited by this paper
• Chem. Pharm. Bull.(オピニオン)

  2007cited by this paper
• The tallysomycin biosynthetic gene cluster from Streptoalloteichus hindustanus E465-94 ATCC 31158 unveiling new insights into the biosynthesis of the bleomycin family of antitumor antibiotics.

  2007cited by this paper
• Kedarcidin chromophore: synthesis of its proposed structure and evidence for a stereochemical revision.

  2007cited by this paper
• The structure of L-tyrosine 2,3-aminomutase from the C-1027 enediyne antitumor antibiotic biosynthetic pathway.

  2007cited by this paper
• The Mechanism of MIO-Based Aminomutases in β-Amino Acid Biosynthesis

  2007cited by this paper
• Single chemical modifications of the C-1027 enediyne core, a radiomimetic antitumor drug, affect both drug potency and the role of ataxia-telangiectasia mutated in cellular responses to DNA double-strand breaks.

  2007cited by this paper
• Designer enediynes generate DNA breaks, interstrand cross-links, or both, with concomitant changes in the regulation of DNA damage responses

  2007cited by this paper
• Characterization of the maduropeptin biosynthetic gene cluster from Actinomadura madurae ATCC 39144 supporting a unifying paradigm for enediyne biosynthesis.

  2007cited by this paper
• The mechanism of MIO-based aminomutases in beta-amino acid biosynthesis.

  2007cited by this paper
• Regiospecific chlorination of (S)-beta-tyrosyl-S-carrier protein catalyzed by SgcC3 in the biosynthesis of the enediyne antitumor antibiotic C-1027.

  2007cited by this paper
• Unusual sugar biosynthesis and natural product glycodiversification

  2007cited by this paper
• Substrate Specificity of the Adenylation Enzyme SgcC1 Involved in the Biosynthesis of the Enediyne Antitumor Antibiotic C-1027*

  2006cited by this paper
• IL-13受体α2降低血吸虫病肉芽肿的炎症反应并延长宿主存活时间[英]/Mentink-Kane MM,Cheever AW，Thompson RW，et al//Proc Natl Acad Sci U S A

  2005cited by this paper
• Biosynthesis of the beta-amino acid moiety of the enediyne antitumor antibiotic C-1027 featuring beta-amino acyl-S-carrier protein intermediates.

  2005cited by this paper
• Antitumor antibiotics: bleomycin, enediynes, and mitomycin.

  2005cited by this paper
• Biosynthesis of the β-Amino Acid Moiety of the Enediyne Antitumor Antibiotic C-1027 Featuring β-Amino Acyl-S-carrier Protein Intermediates

  2005cited by this paper
• The neocarzinostatin biosynthetic gene cluster from Streptomyces carzinostaticus ATCC 15944 involving two iterative type I polyketide synthases.

  2005cited by this paper
• Biochemical characterization of the SgcA1 alpha-D-glucopyranosyl-1-phosphate thymidylyltransferase from the enediyne antitumor antibiotic C-1027 biosynthetic pathway and overexpression of sgcA1 in Streptomyces globisporus to improve C-1027 production.

  2004cited by this paper
• A spectrophotometric assay for measuring and detecting an epoxide hydrolase activity.

  2003cited by this paper
• Kinetic analysis of the 4-methylideneimidazole-5-one-containing tyrosine aminomutase in enediyne antitumor antibiotic C-1027 biosynthesis.

  2003cited by this paper
• Rapid PCR amplification of minimal enediyne polyketide synthase cassettes leads to a predictive familial classification model

  2003cited by this paper
• Polyketide biosynthesis beyond the type I, II and III polyketide synthase paradigms.

  2003cited by this paper
• A genomics-guided approach for discovering and expressing cryptic metabolic pathways

  2003cited by this paper
• A novel 4-methylideneimidazole-5-one-containing tyrosine aminomutase in enediyne antitumor antibiotic C-1027 biosynthesis.

  2003cited by this paper
• Evidence for facile atropisomerism and simple (non-nucleophilic) biradical-forming cycloaromatization within kedarcidin chromophore aglycon.

  2002cited by this paper
• C-O Bond Formation by Polyketide Synthases

  2002cited by this paper
• Biosynthesis of the Enediyne Antitumor Antibiotic C-1027

  2002cited by this paper
• The Calicheamicin Gene Cluster and Its Iterative Type I Enediyne PKS

  2002cited by this paper
• Molecular Cloning: A Laboratory Manual

  2001cited by this paper
• Practical streptomyces genetics

  2000cited by this paper
• Genes for Production of the Enediyne Antitumor Antibiotic C-1027 in Streptomyces globisporus Are Clustered with the cagA Gene That Encodes the C-1027 Apoprotein

  2000cited by this paper
• Enediyne Biosynthesis and Self-Resistance: A Progress Report

  1999cited by this paper
• Comprehensive Natural Products Chemistry

  1999cited by this paper
• GeneMark.hmm: new solutions for gene finding.

  1998cited by this paper
• Neocarzinostatin : the past, present, and future of an anticancer drug

  1997cited by this paper
• Minimal Streptomyces sp. strain C5 daunorubicin polyketide biosynthesis genes required for aklanonic acid biosynthesis

  1997cited by this paper
• Synthetic Study of Kedarcidin Chromophore: Revised Structure

  1997cited by this paper
• Sequential 1H, 13C, and 15N NMR assignments and solution conformation of apokedarcidin.

  1994cited by this paper
• Kedarcidin chromophore: an enediyne that cleaves DNA in a sequence-specific manner.

  1993cited by this paper
• Chemistry and structure elucidation of the kedarcidin chromophore

  1993cited by this paper
• Kedarcidin, a new chromoprotein antitumor antibiotic. II. Isolation, purification and physico-chemical properties.

  1992cited by this paper
• Kedarcidin, a new chromoprotein antitumor antibiotic : structure elucidation of kedarcidin chromophore

  1992cited by this paper
• Chemistry and Biology of the Enediyne Anticancer Antibiotics

  1991cited by this paper
• Kedarcidin, a new chromoprotein antitumor antibiotic. I. Taxonomy of producing organism, fermentation and biological activity.

  1991cited by this paper
• Calichemicins, a novel family of antitumor antibiotics. 1. Chemistry and partial structure of calichemicin .gamma.1I

  1987cited by this paper
• The structure of neocarzinostatin chromophore possessing a novel bicyclo-[7,3,0]dodecadiyne system

  1985cited by this paper
• L-β-(5-Hydroxy-2-pyridyl)-alanine and L-β-(3-Hydroxyureido)-alanine from Streptomyces

  1975cited by this paper
• L-beta-(5-hydroxy-2-pyridyl)-alanine and L-beta-(3-hydroxyureido)-alanine from Streptomyces.

  1975cited by this paper

• Taxonomic Identification, Complete Genome Sequencing, and In Silico Genome Mining of the Actinobacterium Lentzea sp. JNUCC 0626 Isolated from Jeju Gotjawal

  2025cites this paper
• Rational Engineering of Secondary Metabolic Pathways in a Heterologous Host to Enable the Biosynthesis of Hibarimicin Derivatives with Enhanced Anti-Melanomic Activity

  2024cites this paper
• Genomic Insights and Functional Analysis Reveal Plant Growth Promotion Traits of Paenibacillus mucilaginosus G78

  2023cites this paper
• Samarium(ii) iodide-mediated reactions applied to natural product total synthesis

  2022cites this paper
• Metabolomics and Genomics Enable the Discovery of a New Class of Nonribosomal Peptidic Metallophores from a Marine Micromonospora.

  2022cites this paper
• Discovery of pentaene polyols by the activation of an enediyne gene cluster: biosynthetic implications for 9-membered enediyne core structures

  2022cites this paper
• Targeted Discovery of an Enediyne-Derived Cycloaromatized Compound, Jejucarboside A, from a Marine Actinomycete.

  2022cites this paper
• Pentaminomycins F and G, Nonribosomal Peptides Containing 2-Pyridylalanine.

  2021cites this paper
• Identification and Analysis of the Biosynthetic Gene Cluster for the Indolizidine Alkaloid Iminimycin in Streptomyces griseus

  2021cites this paper
• Comparative Genomic and Metabolic Analysis of Streptomyces sp. RB110 Morphotypes Illuminates Genomic Rearrangements and Formation of a New 46-Membered Antimicrobial Macrolide.

  2021cites this paper
• Beyond peptide bond formation: the versatile role of condensation domains in natural product biosynthesis.

  2021cites this paper
• Pentaminomycins F and G, First Non-Ribosomal Peptides Containing 2-Pyridylalanine

  2020cites this paper
• Type II non-ribosomal peptide synthetase proteins: structure, mechanism, and protein-protein interactions.

  2020cites this paper
• A convergent total synthesis of the kedarcidin chromophore: 20-years in the making

  2019cites this paper
• Comparison of Antibiotic Resistance Mechanisms in Antibiotic-Producing and Pathogenic Bacteria

  2019cites this paper
• Biosynthesis of Enediyne Natural Products

  2019cites this paper
• Recent Progress in Unusual Carbohydrate-Containing Natural Products Biosynthesis

  2019cites this paper
• Iterative Methylations Resulting in the Biosynthesis of the t-Butyl Group Catalyzed by a B12-Dependent Radical SAM Enzyme in Cystobactamid Biosynthesis.

  2018cites this paper
• Complete Genome of Micromonospora sp. Strain B006 Reveals Biosynthetic Potential of a Lake Michigan Actinomycete.

  2018cites this paper
• Structural Insights into the Free-Standing Condensation Enzyme SgcC5 Catalyzing Ester-Bond Formation in the Biosynthesis of the Enediyne Antitumor Antibiotic C-1027.

  2018cites this paper
• Comparison of Strategies to Overcome Drug Resistance: Learning from Various Kingdoms

  2018cites this paper
• Two-Component FAD-Dependent Monooxygenases: Current Knowledge and Biotechnological Opportunities

  2018cites this paper
• Mechanistic insights into class B radical-S-adenosylmethionine methylases: ubiquitous tailoring enzymes in natural product biosynthesis.

  2016cites this paper
• Crystal Structure of SgcJ, An NTF2-Like Superfamily Protein Involved in Biosynthesis of the 9-Membered Enediyne Antitumor Antibiotic C-1027

  2016cites this paper
• Genome neighborhood network reveals insights into enediyne biosynthesis and facilitates prediction and prioritization for discovery

  2016influential citation
• Strain Prioritization and Genome Mining for Enediyne Natural Products

  2016cites this paper
• Crystal Structures of SgcE6 and SgcC, the Two-Component Monooxygenase That Catalyzes Hydroxylation of a Carrier Protein-Tethered Substrate during the Biosynthesis of the Enediyne Antitumor Antibiotic C-1027 in Streptomyces globisporus

  2016cites this paper
• Molecular architecture of KedS8, a sugar N‐methyltransferase from Streptoalloteichus sp. ATCC 53650

  2015cites this paper
• Glycosyltransferases: mechanisms and applications in natural product development.

  2015cites this paper
• Three‐Membered Heterocyclic Rings and Their Fused Derivatives

  2015cites this paper
• Seamless stitching of biosynthetic gene cluster containing type I polyketide synthases using Red/ET mediated recombination for construction of stably co-existing plasmids.

  2015cites this paper
• The crystal structure of BlmI as a model for nonribosomal peptide synthetase peptidyl carrier proteins

  2014cites this paper
• GTTAAGGGATTTTG TTCTAAATACATTCAAATATGTATCCGCTCATGAATTAATTC ATGAG CTCAGCCAATCGA AGTTTATCACAGTTAAATTGCTAACGCAGTCAGGCACCGTGT CGA TCCCGCGAAATTAAT TTGGAGTGGTGAATCCGTTAGCGAGGTGCCGCCGGCTTCCAT CA AAAAACCCCTCAAGAC AGTCTAGATTAATTAAGAAGGAGATATACATATGCCGGGTGTTTTAGGG TTCTGCAGTCGCCATCAGCGCCTGTG AACTGCAGAAAGTACTGCC

  2014cites this paper
• Enediyne Polyketide Synthases Stereoselectively Reduce the β-Ketoacyl Intermediates to β-d-Hydroxyacyl Intermediates in Enediyne Core Biosynthesis

  2014cites this paper
• Enediynes: Exploration of microbial genomics to discover new anticancer drug leads

  2014cites this paper
• Iterative type I polyketide synthases involved in enediyne natural product biosynthesis

  2014cites this paper
• A new member of the 4-methylideneimidazole-5-one–containing aminomutase family from the enediyne kedarcidin biosynthetic pathway

  2013cites this paper
• Predictive model for epoxide hydrolase-generated stereochemistry in the biosynthesis of nine-membered enediyne antitumor antibiotics.

  2013cites this paper
• Identification of the incednine biosynthetic gene cluster: characterization of novel β-glutamate-β-decarboxylase IdnL3

  2013cites this paper