Oxy radicals production and control in the chloroplast of Mn-treated rice

No abstract is available for this paper.

• Publication year

  2000

• Venue

  Plant Science

• Publication date

  2000-03-07

• Fields of study

  Biology, Environmental Science

• Identifiers
  DOI 10.1016/S0168-9452(99)00179-X
• External record

  Open on Semantic Scholar

• Source metadata

  Semantic Scholar

• No claims are published for this paper.

• No concepts are published for this paper.

• superoxide dismutase

  2020influential reference
• Regulation and Properties of Plant Catalases

  2019cited by this paper
• Defense against Photooxidative Damage in Plants

  1997influential reference
• 8 – Functions of Mineral Nutrients: Macronutrients

  1995cited by this paper
• 9 – Functions of Mineral Nutrients: Micronutrients

  1995cited by this paper
• Activated oxygen production and detoxification in wheat plants subjected to a water deficit programme

  1995cited by this paper
• Chemical changes and O2˙− production in thylakoid membranes under water stress

  1993cited by this paper
• Causes of Photooxidative Stress and Amelioration of Defense Systems in Plants

  1993cited by this paper
• Copper-mediated oxygen toxicity in rice chloroplasts

  1993cited by this paper
• Limiting Step on Photosynthesis of Rice Plants Treated with Varying Copper Levels

  1991cited by this paper
• Biochemistry of oxygen toxicity.

  1989cited by this paper
• More manganese accumulates in maple sun leaves than in shade leaves.

  1989influential reference
• Early Inhibition of Photosynthesis during Development of Mn Toxicity in Tobacco.

  1988cited by this paper
• Colorimetric assay for methanesulfinic acid in biological samples.

  1987cited by this paper
• Enzymatic reactions of ascorbate and glutathione that prevent peroxide damage in soybean root nodules.

  1986influential reference
• Nature of manganese complexes in manganese accumulator plant. Acanthopanax sciadophylloides

  1984cited by this paper
• Tolerances of 20 Rice Cultivars to Excess Al and Mn1

  1983cited by this paper
• Methods of Analysis for Soils, Plants, and Waters

  1982cited by this paper
• Isozyme Pattern of the Metalloenzyme System Superoxide Dismutase During Growth of Peas (Pisum sativum L.) Under Different Iron Nutrient Concentrations

  1981cited by this paper
• Hydrogen Peroxide is Scavenged by Ascorbate-specific Peroxidase in Spinach Chloroplasts

  1981influential reference
• The Physiology of Metal Toxicity in Plants

  1978cited by this paper
• Superoxide‐dependent production of hydroxyl radical catalyzed by iron—EDTA complex

  1978cited by this paper
• Catalase Activity in Leaves and Cotyledons During Plant Development and Senescence1)1) Part X of the series "Studies on Leaf Senescence". Supported in part by a Grant from the Council of Scientific and Industrial Research, Government of India to D.M.

  1978cited by this paper
• Superoxide dismutase. An enzymic function for erythrocuprein (hemocuprein).

  1969cited by this paper
• Protein measurement with the Folin phenol reagent.

  1951cited by this paper
• COPPER ENZYMES IN ISOLATED CHLOROPLASTS. POLYPHENOLOXIDASE IN BETA VULGARIS.

  1949cited by this paper

• Novel Insights Into Manganese Toxicity Mitigation: Biogenic Calcium Phosphate Nanoparticles Boost Antioxidant Defense and Gene Expression in Wheat

  2025cites this paper
• The cold-responsive C-repeat binding factors in Betula platyphylla Suk. positively regulate cold tolerance.

  2024cites this paper
• Mycorrhizal Colonization of Wheat by Intact Extraradical Mycelium of Mn-Tolerant Native Plants Induces Different Biochemical Mechanisms of Protection

  2023cites this paper
• The damage caused by Cd toxicity to photosynthesis, cellular ultrastructure, antioxidant metabolism, and gene expression in young cacao plants are mitigated by high Mn doses in soil

  2023cites this paper
• Manganese toxicity-induced chlorosis in sugarcane seedlings involves inhibition of chlorophyll biosynthesis

  2022cites this paper
• Genetic Relationship, SPAD Reading, and Soluble Sugar Content as Indices for Evaluating the Graft Compatibility of Citrus Interstocks

  2022cites this paper
• Arbuscular Mycorrhiza Extraradical Mycelium Promotes Si and Mn Subcellular Redistribution in Wheat Grown under Mn Toxicity

  2022cites this paper
• Mineral Nutrition of Plants Under Soil Water Deficit Condition: A Review

  2021cites this paper
• Manganese toxicity disrupts indole acetic acid homeostasis and suppresses CO2 assimilation reaction in rice plants

  2021cites this paper
• Manganese toxicity disrupts indole acetic acid homeostasis and suppresses the CO2 assimilation reaction in rice leaves

  2021cites this paper
• Antioxidant status of barley seedlings under conditions of excess manganese

  2021cites this paper
• Toxic levels of manganese in an acidic Cambisol alters antioxidant enzymes activity, element uptake and subcellular distribution in Triticum aestivum.

  2020cites this paper
• Application of Micronutrients in Rice-Wheat Cropping System of South Asia

  2019cites this paper
• Polyamines (spermidine and putrescine) mitigate the adverse effects of manganese induced toxicity through improved antioxidant system and photosynthetic attributes in Brassica juncea.

  2019cites this paper
• Translocation, Leaf Distribution, and Nutritional Status of Manganese in Cucumber Plants as Affected by Foliar Application of Exogenous Amino Acids

  2019cites this paper
• The migration and transformation regular study of metal manganese in surface soil of Yiwang Industrial Park in Shanxi Province, China

  2018cites this paper
• A major QTL controlling the tolerance to manganese toxicity in barley (Hordeum vulgare L.)

  2018cites this paper
• A major QTL controlling the tolerance to manganese toxicity in barley (Hordeum vulgare L.)

  2018cites this paper
• Effects of manganese on the microstructures of Chenopodium ambrosioides L., A manganese tolerant plant

  2016cites this paper
• Effects of Exogenous Salicylic Acid on the Antioxidative System in Bean Seedling Treated with Manganese.

  2015cites this paper
• Effects of Dietary Manganese on Oxidative Damage of the Neurons in Cocks

  2015cites this paper
• 24-Epibrassinolide mitigates the adverse effects of manganese induced toxicity through improved antioxidant system and photosynthetic attributes in Brassica juncea

  2015cites this paper
• Impact of industrial effluent on growth and yield of rice (Oryza sativa L.) in silty clay loam soil.

  2015cites this paper
• Salicylic acid enhances antioxidant system in Brassica juncea grown under different levels of manganese.

  2014cites this paper
• Manganese treatment effects on terpene compounds of Cuminum cyminum flowers

  2014cites this paper
• In UV-B Irradiated Rice High Levels of Mn Limits Chloroplasts Injury Triggered by Oxidative Stress

  2014cites this paper
• UV-B irradiation in rice: A general Glance About the Control of Oxidative Burst within the chloroplast lamellae

  2014cites this paper
• Comparison of photosynthesis recovery dynamics in floating leaves of Trapa natans after inhibition by manganese or molybdenum: effects on Photosystem II.

  2013cites this paper
• Decay of the Chloroplast Pool of Ascorbate Switches on the Oxidative Burst in UV‐B‐Irradiated Rice

  2012cites this paper
• Fungistatic action of Aureobasidium pullulans on Penicillium expansum in “Rocha” pear: implications for oxidative stress during fruit storage

  2012cites this paper
• Silicon ameliorates manganese toxicity in cucumber by decreasing hydroxyl radical accumulation in the leaf apoplast.

  2012cites this paper
• DIFFERENTIAL RESPONSE OF TWO OLIVE CULTIVARS TO EXCESS MANGANESE

  2012cites this paper
• Responses of cucumber grown in recirculating nutrient solution to gradual Mn and Zn accumulation in the root zone owing to excessive supply via the irrigation water

  2012cites this paper
• Limonene synthase gene expression under different concentrations of manganese in Cuminum cyminum L.

  2012cites this paper
• Gene Primers 5 '-3 ' Product ( bp ) Limonene synthase Forward : GATGATATTTACGATGTCTATGGTAC 490 Reverse : GAATTGATTTCGGCACATCGCCTC-Tubulin synthase Forward : CAGCCAGATCTTCACGAGCTT 119 Reverse

  2012cites this paper
• Manganese-excess induces oxidative stress, lowers the pool of antioxidants and elevates activities of key antioxidative enzymes in rice seedlings

  2011cites this paper
• Soil metals, chloroplasts, and secure crop production: a review

  2011influential citation
• Manganês na nutrição e na produção de massa seca do capim-mombaça = Manganese in the nutrition and dry mass production of the mombaça grass

  2011cites this paper
• Increased Tolerance to Abiotic Stresses in Tobacco Plants Expressing a Barley Cell Wall Peroxidase

  2011cites this paper
• Effects of manganese on the growth, photosystem II and SOD activity of the dinoflagellate Amphidinium sp.

  2011cites this paper
• Influence of Manganese Deficiency on Metal Ion Uptake, Antioxidant Defense Mechanism and Lipid Peroxidation Levels in Mentha Piperita Leaves

  2011cites this paper
• Manganese induced changes in growth, chlorophyll content and antioxidants activity in seedlings of broad bean (Vicia faba L.).

  2011cites this paper
• Modification of reactive oxygen species scavenging capacity of chloroplasts through plastid transformation

  2011cites this paper
• Effects of Salinity Stress on the Structure of Bundle Sheath and Mesophyll Chloroplasts in NAD-Malic Enzyme and PCK Type C4 Plants

  2010cites this paper
• Biochemical and molecular characterization of the antioxidative system of Coffea sp. under cold conditions in genotypes with contrasting tolerance.

  2010cites this paper
• MANGANESE AS ESSENTIAL AND TOXIC ELEMENT FOR PLANTS: TRANSPORT, ACCUMULATION AND RESISTANCE MECHANISMS

  2010influential citation
• Effects of Hypoxia Stress and Different Level of Mn2+ on Antioxidant Enzyme of Tomato Seedlings

  2010cites this paper
• Effects of exogenous nitric oxide on growth and transcriptional expression of antioxidant enzyme mRNA in tomato seedlings under copper stress.

  2010cites this paper
• Heavy Metals and Plastid Metabolism

  2010cites this paper
• Effects of Exogenous Silicon on Photosynthetic Capacity and Antioxidant Enzyme Activities in Chloroplast of Cucumber Seedlings under Excess Manganese

  2009cites this paper
• Manganese uptake and interactions with cadmium in the hyperaccumulator--Phytolacca Americana L.

  2008cites this paper
• Effects of exogenous salicylic acid on manganese toxicity, element contents and antioxidative system in cucumber

  2008cites this paper
• Tillage and residue management effects on soil quality in maize and wheat systems in the highlands of Central Mexico

  2008cites this paper
• Mn-induced changes in leaf structure and chloroplast ultrastructure of Citrus volkameriana (L.) plants.

  2007cites this paper
• Leaf anatomy and chloroplast ultrastructure of Mn-deficient orange plants

  2007cites this paper
• The redox state and activity of superoxide dismutase classes in Arabidopsis thaliana under cadmium or copper stress.

  2007cites this paper
• Responses of Trapa natans L. floating laminae to high concentrations of manganese

  2007cites this paper
• CENTRO DE ENERGIA NUCLEAR NA AGRICULTURA

  2007cites this paper
• Photosystem 2 activity of Citrus volkameriana (L.) leaves as affected by Mn nutrition and irradiance

  2007cites this paper
• Cytokinin-like growth regulators mitigate toxic action of zinc and nickel ions on maize seedlings

  2007cites this paper
• Effect of excess manganese on the antioxidant system in Cucumis sativus L. under two light intensities

  2006cites this paper
• Polyamines as antioxidant protectors against paraquat damage in radish (Raphanus sativus L.) cotyledons

  2006cites this paper
• Combined Effects of Excess Mn and Low pH on Oxidative Stress and Antioxidant Enzymes in Cucumber Roots

  2006cites this paper
• Element accumulation patterns of deciduous and evergreen tree seedlings on acid soils: implications for sensitivity to manganese toxicity.

  2005cites this paper
• Role of pyruvate and ascorbate production in regulation of antioxidant enzymes and membrane LPO levels in Fusarium Acuminatum

  2005cites this paper
• Excess manganese effects on pigments of Mentha spicata at flowering stage

  2005cites this paper
• Silicon-mediated alleviation of Mn toxicity in Cucumis sativus in relation to activities of superoxide dismutase and ascorbate peroxidase.

  2005cites this paper
• Cadmium accumulation and oxidative burst in garlic (Allium sativum).

  2005cites this paper
• Protective role of exogenous spermidine against paraquat toxicity in radish chloroplasts

  2004cites this paper
• Photosynthetic and antioxidant enzyme responses of sugar maple and red maple seedlings to excess manganese in contrasting light environments.

  2004cites this paper
• Copper-induced oxidative stress and antioxidant defence in Arabidopsis thaliana

  2004cites this paper
• Manganese accumulation in rice: implications for photosynthetic functioning.

  2004cites this paper
• Mineral stress: the missing link in understanding how global climate change will affect plants in real world soils

  2004cites this paper
• Biochemical changes in barley plants after excessive supply of copper and manganese

  2004cites this paper
• Kinetics of wound-induced activation of antioxidative enzymes in Oryza sativa: differential activation at different growth stages

  2003cites this paper
• The correlation between antioxidant enzyme activities and lipid peroxidation levels in Mentha pulegium organs grown in Ca2+, Mg2+, Cu2+, Zn2+ and Mn2+ stress conditions

  2003cites this paper
• The Activity of the Antioxidative System in Cadmium-Treated Arabidopsis thaliana

  2003cites this paper
• Metabolic and ultrastructural responses of lupine embryo axes to sugar starvation.

  2003cites this paper
• Physiology and Biochemistry of Metal Toxicity and Tolerance in Plants

  2002cites this paper
• RICE PLANT STRUCTURAL CHANGES BY ADDITION OF EXCESS MANGANESE

  2002cites this paper
• MICRONUTRIENT UPTAKE AND TRANSLOCATION IN Mn-TREATED RICE

  2002cites this paper
• LIPID, CARBOHYDRATE, AND PROTEIN ACCUMULATION IN Mn-TREATED RICE

  2002cites this paper
• Functions of Enzymes in Heavy Metal Treated Plants

  2002cites this paper
• Tolerance of rice to excess manganese in the early stages of vegetative growth. Characterisation of manganese accumulation

  2001cites this paper
• Photoinhibition in Chilling Stressed Wheat and Maize

  2001cites this paper
• Photoinhibition in Chilling Stressed Leguminosae: Comparison of Vicia Faba and Pisum Sativum

  2001cites this paper
• Rice tolerance to excess Mn: Implications in the chloroplast lamellae and synthesis of a novel Mn protein

  2000cites this paper
• Investigation of limonene synthase quality articulation in various organs just as the impact of manganese on articulation of this quality in Cuminum cyminum L.

  year unknowncites this paper