Arabidopsis thaliana expresses a second functional flavonol synthase

No abstract is available for this paper.

• Publication year

  2009

• Venue

  FEBS Letters

• Publication date

  2009-06-18

• Fields of study

  Biology, Medicine, Environmental Science

• Identifiers
  DOI 10.1016/j.febslet.2009.05.006PMID 19433090
• External record

  Open on Semantic Scholar

• Source metadata

  Semantic Scholar, PubMed

• No claims are published for this paper.

• No concepts are published for this paper.

• Recombinant expression and functional characterisation of regiospecific flavonoid glucosyltransferases from Hieracium pilosella L.

  2009cited by this paper
• Functional Analysis of a Predicted Flavonol Synthase Gene Family in Arabidopsis1[W][OA]

  2008cited by this paper
• Biochemical and genetic characterization of Arabidopsis flavanone 3beta-hydroxylase.

  2008cited by this paper
• Metabolomic and genetic analyses of flavonol synthesis in Arabidopsis thaliana support the in vivo involvement of leucoanthocyanidin dioxygenase

  2008cited by this paper
• Evolution of Flavone Synthase I from Parsley Flavanone 3β-Hydroxylase by Site-Directed Mutagenesis1[W][OA]

  2007cited by this paper
• Novel transgenic rice overexpressing anthocyanidin synthase accumulates a mixture of flavonoids leading to an increased antioxidant potential.

  2007cited by this paper
• Lounging in a lysosome: the intracellular lifestyle of Coxiella burnetii

  2007cited by this paper
• Differential regulation of closely related R2R3-MYB transcription factors controls flavonol accumulation in different parts of the Arabidopsis thaliana seedling

  2007cited by this paper
• Flavonoid diversity and biosynthesis in seed of Arabidopsis thaliana

  2006cited by this paper
• Expression of a soluble flavone synthase allows the biosynthesis of phytoestrogen derivatives in Escherichia coli

  2006cited by this paper
• Structural and mechanistic studies on anthocyanidin synthase catalysed oxidation of flavanone substrates: the effect of C-2 stereochemistry on product selectivity and mechanism.

  2005cited by this paper
• Molecular evolution of flavonoid dioxygenases in the family Apiaceae.

  2005cited by this paper
• Transcriptional control of flavonoid biosynthesis: a complex network of conserved regulators involved in multiple aspects of differentiation in Arabidopsis.

  2005cited by this paper
• Mechanistic Studies on Three 2-Oxoglutarate-dependent Oxygenases of Flavonoid Biosynthesis

  2004cited by this paper
• Divergent evolution of flavonoid 2‐oxoglutarate‐dependent dioxygenases in parsley 1

  2003cited by this paper
• Flavonol synthase from Citrus unshiu is a bifunctional dioxygenase.

  2003cited by this paper
• In vitro properties of a recombinant flavonol synthase from Arabidopsis thaliana.

  2002cited by this paper
• Evidence for oxidation at C-3 of the flavonoid C-ring during anthocyanin biosynthesis.

  2002cited by this paper
• Structure and mechanism of anthocyanidin synthase from Arabidopsis thaliana.

  2002cited by this paper
• Functional expression and mutational analysis of flavonol synthase from Citrus unshiu.

  2002cited by this paper
• Purification and antigenicity of flavone synthase I from irradiated parsley cells.

  2001cited by this paper
• Flavonoid accumulation patterns of transparent testa mutants of arabidopsis.

  2001cited by this paper
• Flavonoid biosynthesis. A colorful model for genetics, biochemistry, cell biology, and biotechnology.

  2001cited by this paper
• Advances in flavonoid research since 1992.

  2000cited by this paper
• Purification of recombinant flavanone 3beta-hydroxylase from petunia hybrida and assignment of the primary site of proteolytic degradation.

  2000cited by this paper
• Disruption of specific flavonoid genes enhances the accumulation of flavonoid enzymes and end-products in Arabidopsis seedlings

  1999cited by this paper
• Direct evidence for anthocyanidin synthase as a 2-oxoglutarate-dependent oxygenase: molecular cloning and functional expression of cDNA from a red forma of Perilla frutescens.

  1999cited by this paper
• Major flavonoids from Arabidopsis thaliana leaves.

  1999cited by this paper
• Knock-out mutants from an En-1 mutagenized Arabidopsis thaliana population generate phenylpropanoid biosynthesis phenotypes.

  1998cited by this paper
• Characterization of Flavonol Synthase and Leucoanthocyanidin Dioxygenase Genes in Arabidopsis (Further Evidence for Differential Regulation of "Early" and "Late" Genes)

  1997cited by this paper
• Cloning and expression of flavonol synthase from Petunia hybrida.

  1993cited by this paper
• Conversion of Flavanone to Flavone, Dihydroflavonol and Flavonol with an Enzyme System from Cell Cultures of Parsley

  1981cited by this paper
• Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications.

  1979cited by this paper
• Cleavage of Structural Proteins during the Assembly of the Head of Bacteriophage T4

  1970cited by this paper

• Mechanism of ClFLS1 regulated amentoflavone biosynthesis in mediating drought and cold stress tolerance in Cunninghamia lanceolata

  2026cites this paper
• Genome-Wide Identification, Classification and Expression of Flavonol Synthase from Nelumbo nucifera in Defense against Various Stresses

  2025cites this paper
• Insight into the rutin biosynthesis in the unique flavonol synthesis pathway of Tartary buckwheat based on the enzymatic functions of FLSs

  2025cites this paper
• Recent advances in biosynthesis, regulation, and metabolic engineering of flavonoids.

  2025cites this paper
• The transcription factor LBD10 sustains pollen tube growth and integrity by modulating reactive oxygen species homeostasis via the regulation of flavonol biosynthesis in Arabidopsis

  2024cites this paper
• Constructed the metabolic compound accumulation profiles of daylily at different main producing areas using multi-omics techniques

  2024cites this paper
• Strong prevalence of light regime-specific QTL in Arabidopsis detected using automated high-throughput phenotyping in fluctuating or constant light.

  2024cites this paper
• Conserved amino acid residues and gene expression patterns associated with the substrate preferences of the competing enzymes FLS and DFR

  2024influential citation
• Establishment of virus-induced gene-silencing system in Juglans sigillata Dode and functional analysis of JsFLS2 and JsFLS4.

  2024cites this paper
• Leaf pigmentation in Cannabis sativa : Characterization of anthocyanin biosynthesis in colorful Cannabis varieties

  2024cites this paper
• Flavonoids and Other Phenolic Compounds for Physiological Roles, Plant Species Delimitation, and Medical Benefits: A Promising View

  2024cites this paper
• Generation and characterisation of an Arabidopsis thaliana f3h/fls1/ans triple mutant that accumulates eriodictyol derivatives

  2023cites this paper
• Overexpression of a Flavonol Synthase Gene from Apocynum venetum Improves the Salinity Stress Tolerance of Transgenic Arabidopsis thaliana

  2023cites this paper
• Multi-environment association study highlights candidate genes for robust agronomic quantitative trait loci in a novel worldwide Capsicum core collection.

  2023cites this paper
• A flavonol synthase (FLS) gene, GhFLS1, was screened out increasing salt resistance in cotton

  2023cites this paper
• UMAMIT44 is a key player in glutamate export from Arabidopsis chloroplasts.

  2023cites this paper
• Gene editing of authentic Brassica rapa flavonol synthase 1 generates dihydroflavonol-accumulating Chinese cabbage

  2023cites this paper
• The catalytic role of glutathione transferases in heterologous anthocyanin biosynthesis

  2023cites this paper
• Probing the effects of streptomycin on Brassica napus germination and assessing its molecular interactions using extensive molecular dynamics (MD) simulations

  2023cites this paper
• Transcriptome analysis reveals anthocyanin regulation in Chinese cabbage (Brassica rapa L.) at low temperatures

  2022cites this paper
• Modifying Anthocyanins Biosynthesis in Tomato Hairy Roots: A Test Bed for Plant Resistance to Ionizing Radiation and Antioxidant Properties in Space

  2022cites this paper
• Transcriptomics and Metabolomics of Reactive Oxygen Species Modulation in Near-Null Magnetic Field-Induced Arabidopsis thaliana

  2022cites this paper
• Overexpression of RuFLS2 Enhances Flavonol-Related Substance Contents and Gene Expression Levels

  2022cites this paper
• Telomere-to-telomere genome assembly of bitter melon (Momordica charantia L. var. abbreviata Ser.) reveals fruit development, composition and ripening genetic characteristics

  2022cites this paper
• Involvement of the R2R3-MYB transcription factors MYB21 and its homologs in regulating the stamen flavonols accumulation in Arabidopsis

  2021cites this paper
• Characterization of the Brassica napus Flavonol Synthase Gene Family Reveals Bifunctional Flavonol Synthases

  2021cites this paper
• Relationship between the Phenylpropanoid Pathway and Dwarfism of Paspalum seashore Based on RNA-Seq and iTRAQ

  2021cites this paper
• Identification and functional characterization of a new flavonoid synthase gene MdFLS1 from apple

  2021cites this paper
• Involvement of the R2R3-MYB transcription factor MYB21 and its homologs in regulating flavonol accumulation in Arabidopsis stamen

  2021cites this paper
• Metabolic source isotopic pair labeling and genome-wide association are complementary tools for the identification of metabolite-gene associations in plants.

  2021cites this paper
• Functional Characterisation of Banana (Musa spp.) 2-Oxoglutarate-Dependent Dioxygenases Involved in Flavonoid Biosynthesis

  2021cites this paper
• MdMYB8 is associated with flavonol biosynthesis via the activation of the MdFLS promoter in the fruits of Malus crabapple

  2020cites this paper
• Flavonols regulate root hair development by modulating accumulation of reactive oxygen species in the root epidermis

  2020cites this paper
• Biosynthesis of rutin changes in Capparis spinosa due to altered expression of its pathway genes under elicitors’ supplementation

  2020cites this paper
• Flavonols modulate lateral root emergence by scavenging reactive oxygen species in Arabidopsis thaliana

  2020cites this paper
• The spatio-temporal biosynthesis of floral flavonols is controlled by differential phylogenetic MYB regulators in Freesia hybrida.

  2020cites this paper
• Molecular basis for neofunctionalization of duplicated E3 ubiquitin ligases underlying adaptation to drought tolerance in Arabidopsis thaliana.

  2020cites this paper
• Diversity of genetic lesions characterizes new Arabidopsis flavonoid pigment mutant alleles from T-DNA collections.

  2020cites this paper
• Determination of Quercetin and Flavonol Synthase in Boesenbergia rotunda Rhizome.

  2020cites this paper
• The Effects of Ultraviolet A/B Treatments on Anthocyanin Accumulation and Gene Expression in Dark-Purple Tea Cultivar ‘Ziyan’ (Camellia sinensis)

  2020cites this paper
• Modulation of Arabidopsis Flavonol Biosynthesis Genes by Cyst and Root-Knot Nematodes

  2020cites this paper
• Decrease of flavonol synthase enzymatic activity in Ugni molinae Turcz due to the domestication process

  2019cites this paper
• The Origin and Evolution of Plant Flavonoid Metabolism

  2019cites this paper
• The Hot and the Colorful: Understanding the Metabolism, Genetics and Evolution of Consumer Preferred Metabolic Traits in Pepper and Related Species

  2019cites this paper
• Genome-Wide Identification of Direct Targets of the TTG1–bHLH–MYB Complex in Regulating Trichome Formation and Flavonoid Accumulation in Arabidopsis Thaliana

  2019cites this paper
• Bioenergy: Plants and Products

  2019cites this paper
• Anthocyanin Degrading and Chlorophyll Accumulation Lead to the Formation of Bicolor Leaf in Ornamental Kale

  2019cites this paper
• Identification and Functional Analysis of a Flavonol Synthase Gene from Grape Hyacinth

  2019cites this paper
• Characterization of two flavonol synthases with iron-independent flavanone 3-hydroxylase activity from Ornithogalum caudatum Jacq

  2019cites this paper
• The Peroxidative Cleavage of Kaempferol Contributes to the Biosynthesis of the Benzenoid Moiety of Ubiquinone in Plants[OPEN]

  2018influential citation
• Cloning and Characterization of a Flavonol Synthase Gene From Litchi chinensis and Its Variation Among Litchi Cultivars With Different Fruit Maturation Periods

  2018cites this paper
• Evolutionary and functional analyses of the 2-oxoglutarate-dependent dioxygenase genes involved in the flavonoid biosynthesis pathway in tobacco

  2018cites this paper
• Current understanding of the pathways of flavonoid biosynthesis in model and crop plants.

  2017cites this paper
• Identification of functional flavonol synthase genes from fragrant wild cyclamen (Cyclamen purpurascens)

  2017cites this paper
• Mechanisms of protein homeostasis (proteostasis) maintain stem cell identity in mammalian pluripotent stem cells

  2017cites this paper
• TRANSPARENT TESTA GLABRA 1-Dependent Regulation of Flavonoid Biosynthesis

  2017cites this paper
• Silencing of BnTT1 family genes affects seed flavonoid biosynthesis and alters seed fatty acid composition in Brassica napus.

  2017cites this paper
• Identification of a candidate gene for Re, the factor determining the red leaf phenotype in ornamental kale using fine mapping and transcriptome analysis

  2017cites this paper
• Transcriptome analysis of filling stage seeds among three buckwheat species with emphasis on rutin accumulation

  2017cites this paper
• TTCATAGTCTCCGATACCAGATCCTG TATAAAACAGAGTGTTGCGGATCCC TAATGGGAAGGATAATCAGGATCTGG GATAGTGAATCATGGTGTTAAGCCTG GAACGCCCCTGAAGATTG ATCTTGGTGATTTGAGGA CGACACGCTACTCAACACACCACCTCGCACAGCCTCCTCAAGCGGCCGCNNNNNNGCCT CGACACGCTACTCAACAC TCAACACACCACCTCGCACAGC CATTCCCTACACGCCTCTGAT TTCATAGTCTCCGATACCAGATCCTG ATGT

  2016cites this paper
• Cloning, characterization and functional analysis of a flavonol synthase from Vaccinium corymbosum

  2016cites this paper
• Flavonoid Metabolomics in Gerbera hybrida and Elucidation of Complexity in the Flavonoid Biosynthetic Pathway

  2016influential citation
• The Reaumuria trigyna leucoanthocyanidin dioxygenase (RtLDOX) gene complements anthocyanidin synthesis and increases the salt tolerance potential of a transgenic Arabidopsis LDOX mutant.

  2016cites this paper
• Somatic increase of CCT8 mimics proteostasis of human pluripotent stem cells and extends C. elegans lifespan

  2016cites this paper
• Effets de la nutrition azotée sur les baies de différentes combinaisons porte-greffe/greffon de vigne : approches agronomique, métabolomique et transcriptomique

  2015cites this paper
• Effet du statut azoté de la vigne sur le potentiel aromatique de la baie de raisin et l'arôme du vin : Approches agronomique, analytique et transcriptomique

  2015cites this paper
• The Function and Catalysis of 2-Oxoglutarate-Dependent Oxygenases Involved in Plant Flavonoid Biosynthesis

  2014influential citation
• PROTEIN-PROTEIN INTERACTIONS OF THE FLAVONOID BIOSYNTHETIC ENZYMES IN ARABIDOPSIS

  2014influential citation
• Protein-protein interactions of the flavonoid biosynthetic enzymes in Arabidopsis thaliana

  2014cites this paper
• FLAVONOIDS AND THEIR THERAPEUTIC POTENTIAL AS ANTI CANCER AGENTS: BIOSYNTHESIS, METABOLISM AND REGULATION.

  2014cites this paper
• Secondary Metabolites and Environmental Stress in Plants: Biosynthesis, Regulation, and Function

  2014cites this paper
• Natural products – modifying metabolite pathways in plants

  2013cites this paper
• The Interaction between Abiotic and Biotic Stress in Arabidopsis thaliana

  2013cites this paper
• The flavonoid biosynthetic pathway in Arabidopsis: structural and genetic diversity.

  2013cites this paper
• The Flavonoid Pathway in Tomato Seedlings: Transcript Abundance and the Modeling of Metabolite Dynamics

  2013cites this paper
• Functional analyses of a flavonol synthase–like gene from Camellia nitidissima reveal its roles in flavonoid metabolism during floral pigmentation

  2013cites this paper
• The first genetic map of the American cranberry: exploration of synteny conservation and quantitative trait loci

  2013cites this paper
• The evolution of phenylpropanoid metabolism in the green lineage

  2013cites this paper
• Cloning, characterization, and activity analysis of a flavonol synthase gene FtFLS1 and its association with flavonoid content in tartary buckwheat.

  2012cites this paper
• Accumulation of flavonoids and expression of flavonoid biosynthetic genes in tartary and rice-tartary buckwheat

  2012cites this paper
• Feedback inhibition of the general phenylpropanoid and flavonol biosynthetic pathways upon a compromised flavonol-3-O-glycosylation

  2012cites this paper
• Flavonoids: biosynthesis, biological functions, and biotechnological applications

  2012cites this paper
• Analysis of T-DNA alleles of flavonoid biosynthesis genes in Arabidopsis ecotype Columbia

  2012cites this paper
• Negative Regulation of Anthocyanin Biosynthesis in Arabidopsis by a miR156-Targeted SPL Transcription Factor[W][OA]

  2011cites this paper
• Isolation, characterization, and function analysis of a flavonol synthase gene from Ginkgo biloba

  2011influential citation
• Flavonols Accumulate Asymmetrically and Affect Auxin Transport in Arabidopsis1[C][W][OA]

  2011cites this paper
• Biosynthesis and Function of Citrus Glycosylated Flavonoids

  2011cites this paper
• Flavonoid accumulation in Arabidopsis thaliana root galls caused by the obligate biotrophic pathogen Plasmodiophora brassicae.

  2010cites this paper
• Multifunctional flavonoid dioxygenases: flavonol and anthocyanin biosynthesis in Arabidopsis thaliana L.

  2010cites this paper
• Dissertation zur Erlangung des Doktorgrades der Fakultät für Chemie und Pharmazie der Ludwig-Maximilian-Universität München Arabidopsis flavonoid glycosylation impacts on phenylpropanoid biosynthesis and plant growth

  2010cites this paper
• Arabidopsis flavonoid glycosylation impacts on phenylpropanoid biosynthesis and plant growth

  2010cites this paper