Effects of seasonal and latitudinal cold on oxidative stress parameters and activation of hypoxia inducible factor (HIF-1) in zoarcid fish

No abstract is available for this paper.

• Publication year

  2007

• Venue

  Journal of Comparative Physiology □ B

• Publication date

  2007-06-20

• Fields of study

  Biology, Medicine, Environmental Science

• Identifiers
  DOI 10.1007/s00360-007-0173-4PMID 17579869
• External record

  Open on Semantic Scholar

• Source metadata

  Semantic Scholar, PubMed

• No claims are published for this paper.

• No concepts are published for this paper.

• Temperature-dependent lipid levels and components in polar and temperate eelpout (Zoarcidae)

  2008influential reference
• The links between membrane composition, metabolic rate and lifespan.

  2008cited by this paper
• Marine invertebrate mitochondria and oxidative stress.

  2007cited by this paper
• Inactivation of NMD increases viability of sup45 nonsense mutants in Saccharomyces cerevisiae

  2007cited by this paper
• Biology of the Antarctic eelpout Pachycara brachycephalum

  2006influential reference
• Physiological ageing in a polar and a temperate swimming scallop

  2006cited by this paper
• Regulating cellular oxygen sensing by hydroxylation.

  2006cited by this paper
• Temperature-dependent energy allocation to growth in Antarctic and boreal eelpout (Zoarcidae)

  2006influential reference
• Oxidative stress during stressful heat exposure and recovery in the North Sea eelpout Zoarces viviparus L.

  2006cited by this paper
• Oxidative stress and HIF-1 DNA binding during stressful cold exposure and recovery in the North Sea eelpout (Zoarces viviparus).

  2006cited by this paper
• Temperature regulates hypoxia-inducible factor-1 (HIF-1) in a poikilothermic vertebrate, crucian carp (Carassius carassius)

  2006influential reference
• The good, the bad and the ugly in oxygen-sensing: ROS, cytochromes and prolyl-hydroxylases.

  2006influential reference
• Physiological ageing in a temperate and a polar swimming scallop

  2006cited by this paper
• Sensing and responding to hypoxia via HIF in model invertebrates.

  2006cited by this paper
• Thermal sensitivity of uncoupling protein expression in polar and temperate fish.

  2006cited by this paper
• Mechanisms of liver injury. III. Role of glutathione redox status in liver injury.

  2006cited by this paper
• Cloning and expression analysis of two distinct HIF-alpha isoforms – gcHIF-1alpha and gcHIF-4alpha – from the hypoxia-tolerant grass carp, Ctenopharyngodon idellus

  2006cited by this paper
• Aerobic mitochondrial capacities in Antarctic and temperate eelpout (Zoarcidae) subjected to warm versus cold acclimation

  2005cited by this paper
• HIF-1α involvement in low temperature and anoxia survival by a freeze tolerant insect

  2005cited by this paper
• Oxygen-dependent gene expression in fishes.

  2005cited by this paper
• Inhibition of mitochondrial respiration elevates oxygen concentration but leaves regulation of hypoxia-inducible factor (HIF) intact.

  2005influential reference
• Chronological and physiological ageing in a polar and a temperate mud clam.

  2005cited by this paper
• Formation of reactive species and induction of antioxidant defence systems in polar and temperate marine invertebrates and fish.

  2004cited by this paper
• Coping with cold: An integrative, multitissue analysis of the transcriptome of a poikilothermic vertebrate.

  2004cited by this paper
• On the mechanism and biology of cytochrome oxidase inhibition by nitric oxide.

  2004cited by this paper
• Cellular oxygen sensing need in CNS function: physiological and pathological implications

  2004cited by this paper
• Redox state regulates HIF-1α and its DNA binding and phosphorylation in salmonid cells

  2004cited by this paper
• Baltic salmon (Salmo salar) yolk-sac fry mortality is associated with disturbances in the function of hypoxia-inducible transcription factor (HIF-1alpha) and consecutive gene expression.

  2004cited by this paper
• Capillarisation, oxygen diffusion distances and mitochondrial content of carp muscles following acclimation to summer and winter temperatures

  2004influential reference
• Hypoxia-inducible Factor and Its Biomedical Relevance*

  2003influential reference
• EPR studies of in vivo radical production by lipopolysaccharide: potential role of iron mobilized from iron-nitrosyl complexes.

  2003cited by this paper
• Temperature-dependent pH regulation in eurythermal and stenothermal marine fish: an interspecies comparison using 31P-NMR

  2003cited by this paper
• Heat Induction of the Unphosphorylated Form of Hypoxia-inducible Factor-1α Is Dependent on Heat Shock Protein-90 Activity*

  2002cited by this paper
• Oxygen-limited thermal tolerance in Antarctic fish investigated by MRI and (31)P-MRS.

  2002cited by this paper
• Notothenioid fish, krill and phytoplankton from Antarctica contain a vitamin E constituent (alpha-tocomonoenol) functionally associated with cold-water adaptation.

  2002influential reference
• Oxygen-dependent cellular functions--why fishes and their aquatic environment are a prime choice of study.

  2002cited by this paper
• Quantitation of intracellular free iron by electron paramagnetic resonance spectroscopy.

  2002cited by this paper
• Characterization of a hypoxia-inducible factor (HIF-1alpha ) from rainbow trout. Accumulation of protein occurs at normal venous oxygen tension.

  2001influential reference
• HIF‐1 is expressed in normoxic tissue and displays an organ‐specific regulation under systemic hypoxia

  2001cited by this paper
• HIFα Targeted for VHL-Mediated Destruction by Proline Hydroxylation: Implications for O2 Sensing

  2001cited by this paper
• Characterization of a Hypoxia-inducible Factor (HIF-1α) from Rainbow Trout

  2001influential reference
• Redox environment of the cell as viewed through the redox state of the glutathione disulfide/glutathione couple.

  2001influential reference
• Mammalian oxygen sensing, signalling and gene regulation.

  2000cited by this paper
• Antioxidant/Pro-oxidant Equilibrium Regulates HIF-1α and NF-κB Redox Sensitivity

  2000cited by this paper
• Glutathione: Systemic Protectant Against Oxidative and Free Radical Damage Dedicated to the memory of Professor Daniel Mazia, my PhD mentor and a pioneer in cell biology

  2000influential reference
• Antioxidant/pro-oxidant equilibrium regulates HIF-1alpha and NF-kappa B redox sensitivity. Evidence for inhibition by glutathione oxidation in alveolar epithelial cells.

  2000cited by this paper
• A comparison of plasma vitamin C and E levels in two Antarctic and two temperate water fish species.

  2000cited by this paper
• Hypoxia‐induced activation of HIF‐1: role of HIF‐1α‐Hsp90 interaction

  1999cited by this paper
• Hypoxia-induced activation of HIF-1: role of HIF-1alpha-Hsp90 interaction.

  1999cited by this paper
• Physiological disturbances at critically high temperatures: a comparison between stenothermal antarctic and eurythermal temperate eelpouts (Zoarcidae)

  1999cited by this paper
• Extra- and intracellular acid-base balance and ionic regulation in cod (Gadus morhua ) during combined and isolated exposures to hypercapnia and copper

  1997cited by this paper
• Activation of Hypoxia-inducible Transcription Factor Depends Primarily upon Redox-sensitive Stabilization of Its α Subunit*

  1996influential reference
• The roles of free radicals, peroxides and oxidized lipoproteins in second messenger system dysfunction.

  1996cited by this paper
• The transcription factors ATF-1 and CREB-1 bind constitutively to the hypoxia-inducible factor-1 (HIF-1) DNA recognition site.

  1995cited by this paper
• Reversible inhibition of cytochrome c oxidase, the terminal enzyme of the mitochondrial respiratory chain, by nitric oxide

  1994cited by this paper
• Simultaneous determination of Fe(III) and Fe(II) in water solutions and tissue homogenates using desferal and 1,10-phenanthroline.

  1993cited by this paper
• Antioxidant enzymes in the digestive gland of the common musselMytilus edulis

  1992cited by this paper
• Hydroperoxide-initiated chemiluminescence: an assay for oxidative stress in biopsies of heart, liver, and muscle.

  1991cited by this paper
• Influence of Complexation on the Uptake by Plants of Iron, Manganese, Copper and Zinc II. EFFECT OF DTPA IN A MULTI-METAL AND COMPUTER SIMULATION STUDY

  1991cited by this paper
• Glutathione: toxicological implications.

  1990cited by this paper
• Determination of carbonyl content in oxidatively modified proteins.

  1990cited by this paper
• 5-HETE: uptake, distribution, and metabolism in MDCK cells.

  1989cited by this paper
• Thermal acclimation induces adaptive changes in subcellular structure of fish skeletal muscle.

  1989influential reference
• Spin trapping: ESR parameters of spin adducts.

  1988influential reference
• Reduction of Fe(III)ADP complex by liver microsomes.

  1988influential reference
• Spin trapping: ESR parameters of spin adducts.

  1987influential reference
• High-performance liquid chromatography of thiols and disulfides: dinitrophenol derivatives.

  1987cited by this paper
• Doxorubicin-dependent lipid peroxidation at low partial pressures of O2.

  1985cited by this paper
• Free radicals in biology and medicine

  1985influential reference
• Vitamin E analysis methods for animal tissues.

  1984influential reference
• Increased microsomal oxidation of hydroxyl radical scavenging agents and ethanol after chronic consumption of ethanol.

  1983influential reference
• Determination of malonaldehyde precursor in tissues by thiobarbituric acid test.

  1978cited by this paper
• A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding.

  1976cited by this paper
• [73] Determination of nonheme iron, total iron, and copper

  1967cited by this paper
• THE FATE OF THORIUM DIOXIDE INJECTED INTO THE PEDAL SINUS OF BULLIA (GASTROPODA: PROSOBRANCHIATA)

  1965cited by this paper
• The FASEB Journal express article 10.1096/fj.04-2758fje. Published online December 1, 2004.

  year unknowncited by this paper

• Morphology, transcriptome, and proteome analysis of gill tissue in Acanthopagrus latus infected with Cryptocaryon irritans

  2025cites this paper
• Comparative study of fish adaptation at cellular and genetic levels across eco-sensitive zones with contrasting oxygen and temperature regimes

  2025cites this paper
• Effects of Cold Shock on the State of the Antioxidant Enzyme Complex in Tissues of Scorpaena porcus L., 1758

  2025cites this paper
• Dissecting Oxidative Stress and Organismic Response to a Temperature Gradient in the Midge Chironomus riparius

  2025cites this paper
• Effect of hypoxia in the post-hatching development of the salmon (Salmo salar L.) spinal cord

  2024cites this paper
• Red porgy's (Pagrus pagrus) cellular physiology and antioxidant defense in response to seasonality.

  2023cites this paper
• Insights Into miRNA-mRNA Regulatory Mechanisms of Cold Adaptation in Gymnocypris eckloni: Ubiquitin-Mediated Proteolysis Is Pivotal for Adaptive Energy Metabolism

  2022cites this paper
• Life in the freezer: protein metabolism in Antarctic fish

  2022cites this paper
• Gradual increase of temperature trigger metabolic and oxidative responses in plasma and body tissues in the Antarctic fish Notothenia rossii

  2022cites this paper
• Synergistic effect of long-term feed deprivation and temperature on the cellular physiology of meagre (Argyrosomus regius).

  2022cites this paper
• Effect of cold stress on the MAPK pathway and lipidomics on muscle of Takifugu fasciatus

  2021cites this paper
• The evolutionary and physiological significance of the Hif pathway in teleost fishes.

  2021cites this paper
• Transcriptional and Catalytic Responsiveness of the Antarctic Fish Trematomus bernacchii Antioxidant System toward Multiple Stressors

  2021cites this paper
• Effects of a gradual increase in temperature on the antioxidant defense system and plasma metabolic parameters in Antarctic fish Notothenia rossii

  2021cites this paper
• Treatment with ascorbic acid normalizes the aerobic capacity, antioxidant defence, and cell death pathways on thermally stressed Mytilus galloprovincialis.

  2021cites this paper
• Integrating antioxidant responses and oxidative stress of ornamental discus (Symphysodon spp.) to decreased temperatures: Evidence for species-specific thermal resistance

  2021cites this paper
• Hypoxia tolerance in two amazon cichlids: mitochondrial respiration and cellular metabolism adjustments are result of species environmental preferences and distribution

  2021cites this paper
• A mixture of Chinese herbs and a commercial probiotic Bacillus species improves hemato-immunological, stress, and antioxidant parameters, and expression of HSP70 and HIF-1α mRNA to hypoxia, cold, and heat stress in Nile tilapia, Oreochromis niloticus

  2020cites this paper
• Advances in understanding the impacts of global warming on marine fishes farmed offshore: Sparus aurata as a case study.

  2020cites this paper
• Adjustments of cardiac mitochondrial phenotype in a warmer thermal habitat is associated with oxidative stress in European perch, Perca fluviatilis

  2020cites this paper
• Oxidative stress responsive transcription factors in cellular signalling transduction mechanisms.

  2020cites this paper
• Sensitivity in the antioxidant system of discus fish (Symphysodon spp.) to cold temperature: evidence for species-specific cold resistance

  2019cites this paper
• Cardiac mitochondrial plasticity and thermal sensitivity in a fish inhabiting an artificially heated ecosystem

  2019cites this paper
• Gastric Mucosal Lesions in Tibetans with High-Altitude Polycythemia Show Increased HIF-1A Expression and ROS Production

  2019cites this paper
• Variability and change in the west Antarctic Peninsula marine system: Research priorities and opportunities

  2019cites this paper
• Network of microRNA-transcriptional factor-mRNA in cold response of turbot Scophthalmus maximus

  2019cites this paper
• Antarctic Marine Biodiversity: Adaptations, Environments and Responses to Change

  2018cites this paper
• Hypoxia-inducible transcription factors in fish: expression, function and interconnection with the circadian clock

  2018cites this paper
• DNA damage and oxidative stress in long-lived aquatic organisms.

  2018cites this paper
• Expression of aryl hydrocarbon receptor–regulated genes and superoxide dismutase in the Antarctic eelpout Pachycara brachycephalum exposed to benzo[a]pyrene

  2018influential citation
• Seasonal Changes in Metabolism and Cellular Stress Phenomena in the Gilthead Sea Bream (Sparus aurata)

  2018cites this paper
• Antioxidant defenses in polar cod (Boreogadus saida) and responsiveness toward dietary crude oil exposure.

  2017cites this paper
• Antioxidant Defense System Alternations in Fish as a Bio-Indicator of Environmental Pollution

  2017cites this paper
• Uptake Kinetics and Subcellular Compartmentalization Explain Lethal but Not Sublethal Effects of Cadmium in Two Closely Related Amphipod Species.

  2017cites this paper
• Nrf2 and regulation of the antioxidant system in the Antarctic silverfish, Pleuragramma antarctica: Adaptation to environmental changes of pro-oxidant pressure.

  2017cites this paper
• Effects of increasing temperature on antioxidant defense system and oxidative stress parameters in the Antarctic fish Notothenia coriiceps and Notothenia rossii.

  2017cites this paper
• Effects of heat stress on the renal and branchial carbohydrate metabolism and antioxidant system of Antarctic fish

  2017cites this paper
• Hyperoxia Does Not Extend Critical Thermal Maxima (CTmax) in White- or Red-Blooded Antarctic Notothenioid Fishes

  2016cites this paper
• Alterations of the immune transcriptome in resistant and susceptible hard clams (Mercenaria mercenaria) in response to Quahog Parasite Unknown (QPX) and temperature.

  2016cites this paper
• Characterization of cold-associated microRNAs in the freeze-tolerant gall fly Eurosta solidaginis using high-throughput sequencing.

  2016cites this paper
• Dietary lipid concentration affects liver mitochondrial DNA copy number, gene expression and DNA methylation in large yellow croaker (Larimichthys crocea).

  2016cites this paper
• Biochemical and physiological modifications in tissues of Sardina pilchardus: spatial and temporal patterns as a baseline for biomonitoring studies

  2015cites this paper
• Cold acclimation increases levels of some heat shock protein and sirtuin isoforms in threespine stickleback.

  2015influential citation
• Transcriptional events co-regulated by hypoxia and cold stresses in Zebrafish larvae

  2015cites this paper
• Impact of Thermal Stress on Kidney-Specific Gene Expression in Farmed Regional and Imported Rainbow Trout

  2015cites this paper
• Synergistic effects of acute warming and low pH on cellular stress responses of the gilthead seabream Sparus aurata

  2015cites this paper
• Metabolic compensations in mitochondria isolated from the heart, liver, kidney, brain and white muscle in the southern catfish (Silurus meridionalis) by seasonal acclimation.

  2015cites this paper
• Temperature acclimation of mitochondria function from the hearts of a temperate wrasse (Notolabrus celidotus).

  2015cites this paper
• Alterations in mitochondrial electron transport system activity in response to warm acclimation, hypoxia-reoxygenation and copper in rainbow trout, Oncorhynchus mykiss.

  2015cites this paper
• Warmer water temperature results in oxidative damage in an Antarctic fish, the bald notothen

  2015cites this paper
• Physiological responses and HSP70 mRNA expression of GIFT strain of Nile tilapia (Oreochromis niloticus) under cold stress

  2015cites this paper
• CTCCACTGCT TATGGCGGCTGAGGAAG TCAAACTGTGG GTGCCAACCTGGATGAGC TATGGCAACGA GGTCACTGGCATTGGTCAC GATCCACGAAGCC TGGTCTTTCCAGTGAGTATGAGCC GTTATGCCCTGCC TGAAGGAGTAACCGCGCTCTGT GGACGCACACTG GCAGACGGGCATAGCACTTG AGCCTAACAT TACCTCCAGACAGCACGG CCATAGCCCACA GTGGCTGGCACGAGTTTGA AGCCTTCATT GCGATGAATAGGGAAAGCA GGTG

  2015cites this paper
• Combined Effects of Copper and Temperature on Antioxidant Enzymes in the Black Rockfish Sebastes schlegeli

  2014influential citation
• Transcriptional regulation of hypoxia inducible factors alpha (HIF-α) and their inhibiting factor (FIH-1) of channel catfish (Ictalurus punctatus) under hypoxia.

  2014cites this paper
• Testing the role of heart mitochondrial stability and function in heart failure of ectotherms exposed to heat stress

  2014cites this paper
• The Physiological and Behavioral Responses of Yellow Perch to Hypoxia

  2014cites this paper
• Tissue and Cell Membrane Lipid Composition in Rats on Adaptation to Highland Conditions

  2013cites this paper
• The glutathione-dependent system of antioxidant defense is not modulated by temperature acclimation in muscle tissues from striped bass, Morone saxatilis.

  2013cites this paper
• Seasonal variations of anti-/apoptotic and antioxidant proteins in the heart and gastrocnemius muscle of the water frog Pelophylax ridibundus.

  2013cites this paper
• Histología de branquias, hígado y riñón de juveniles del pez neotropical Colossoma macropomum (Characiformes, Characidae) expuesto a tres temperaturas

  2013cites this paper
• Validation of Antibodies Used to Study Hypoxia Inducible Factors in Two Species of Fundulus

  2013cites this paper
• Molecular adaptation and thermal plasticity in a cold-adapted Antarctic fish

  2013cites this paper
• Differential responses of juvenile and adult South African abalone (Haliotis midae Linnaeus) to low and high oxygen levels.

  2013cites this paper
• Interaction of temperature and an environmental stressor: Moina macrocopa responds with increased body size, increased lifespan, and increased offspring numbers slightly above its temperature optimum.

  2013cites this paper
• [Histology of gill, liver and kidney in juvenile fish Colossoma macropomum exposed to three temperatures].

  2013cites this paper
• Biochemical responses of freshwater fish Carassius auratus to polycyclic aromatic hydrocarbons and pesticides

  2012cites this paper
• Evolutionary Adaptation and Disaptation in the Cold: the Icefish Paradigm

  2012cites this paper
• Cardiac overexpression of metallothionein rescues cold exposure-induced myocardial contractile dysfunction through attenuation of cardiac fibrosis despite cardiomyocyte mechanical anomalies.

  2012cites this paper
• Metabolic shifts in the Antarctic fish Notothenia rossii in response to rising temperature and PCO2

  2012cites this paper
• Effects of temperature and dietary protein level on hepatic oxidative status of Senegalese sole juveniles (Solea senegalensis).

  2012cites this paper
• Mechanisms defining thermal limits and adaptation in marine ectotherms: an integrative view.

  2012cites this paper
• Adaptation and Evolution in Marine Environments, Volume 1: The Impacts of Global Change on Biodiversity

  2012cites this paper
• Oxidative stress is transient and tissue specific during cold acclimation of threespine stickleback

  2011influential citation
• Protein Carbonyl Measurement by Enzyme Linked Immunosorbent Assay

  2011cites this paper
• Oxidative Challenges in Polar Seas

  2011cites this paper
• ANTARCTIC FISH METABOLIC RESPONSES AS POTENTIAL BIOMARKERS OF ENVIRONMENTAL IMPACT

  2011cites this paper
• Guideline for Sampling and Sample treatment : Eelpout (Zoarces viviparus)

  2011cites this paper
• How will fish that evolved at constant sub‐zero temperatures cope with global warming? Notothenioids as a case study

  2011cites this paper
• Molecular characterization and mRNA expression of two key enzymes of hypoxia-sensing pathways in eastern oysters Crassostrea virginica (Gmelin): hypoxia-inducible factor α (HIF-α) and HIF-prolyl hydroxylase (PHD).

  2011cites this paper
• Mitochondrial biogenesis in cold-bodied fishes

  2011cites this paper
• Exploring Uncoupling Proteins and Antioxidant Mechanisms under Acute Cold Exposure in Brains of Fish

  2011cites this paper
• Environmentally induced oxidative stress in aquatic animals.

  2011cites this paper
• eview nvironmentally induced oxidative stress in aquatic animals

  2010cites this paper
• Poor acclimation capacities in Antarctic marine ectotherms

  2010cites this paper
• Chapter 4 Oxygen and Capacity Limited Thermal Tolerance

  2009cites this paper
• Adaptation and stress defence in intertidal and subtidal Antarctic limpets (Nacella concinna): A study of the plasticity of molecular and biochemical stress response in Antarctic invertebrates.

  2009cites this paper
• The Antarctic hemoglobinless icefish, fifty five years later: a unique cardiocirculatory interplay of disaptation and phenotypic plasticity.

  2009cites this paper
• Protein synthesis is lowered while 20S proteasome activity is maintained following acclimation to low temperature in juvenile spotted wolffish (Anarhichas minor Olafsen)

  2009cites this paper
• Chapter 6 Blood‐Gas Transport and Hemoglobin Function: Adaptations for Functional and Environmental Hypoxia

  2009cites this paper
• Evolution and Regulation of the Downstream Gene of Hypoxia-Inducible Factor-1α in Naked Carp (Gymnocypris przewalskii) from Lake Qinghai, China

  2008cites this paper
• The cold but not hard fats in ectotherms: consequences of lipid restructuring on susceptibility of biological membranes to peroxidation, a review

  2008cites this paper
• From critters to cancers: bridging comparative and clinical research on oxygen sensing, HIF signaling, and adaptations towards hypoxia.

  2007cites this paper
• From critters to cancers : bridging comparative and clinical research on oxygen sensing , HIF signaling , and adaptations towards hypoxia

  2007cites this paper