Effects of nitrogen catabolite repression and di-ammonium phosphate addition during wine fermentation by a commercial strain of S. cerevisiae

No abstract is available for this paper.

• Publication year

  2011

• Venue

  Applied Microbiology and Biotechnology

• Publication date

  2011-01-19

• Fields of study

  Biology, Medicine, Environmental Science

• Identifiers
  DOI 10.1007/s00253-011-3084-yPMID 21246356
• External record

  Open on Semantic Scholar

• Source metadata

  Semantic Scholar, PubMed

• No claims are published for this paper.

• No concepts are published for this paper.

• Analysis of S-3-(Hexan-1-ol)-Glutathione and S-3-(Hexan-1-ol)-l-Cysteine in Vitis vinifera L. cv. Koshu for Aromatic Wines

  2010cited by this paper
• Synthesis of wine thiol conjugates and labeled analogues: fermentation of the glutathione conjugate of 3-mercaptohexan-1-ol yields the corresponding cysteine conjugate and free thiol.

  2010cited by this paper
• A database of microsatellite genotypes for Saccharomyces cerevisiae

  2009cited by this paper
• Comprehensive polymorphism survey elucidates population structure of Saccharomyces cerevisiae

  2009cited by this paper
• New Zealand Sauvignon blanc Distinct Flavor Characteristics: Sensory, Chemical, and Consumer Aspects

  2009cited by this paper
• Nitrogen catabolic repression controls the release of volatile thiols by Saccharomyces cerevisiae during wine fermentation.

  2008influential reference
• New insights on 3-mercaptohexanol (3MH) biogenesis in Sauvignon Blanc wines: Cys-3MH and (E)-hexen-2-al are not the major precursors.

  2008influential reference
• Dynamics of the yeast transcriptome during wine fermentation reveals a novel fermentation stress response.

  2008influential reference
• Nitrogen catabolite repression modulates the production of aromatic thiols characteristic of Sauvignon Blanc at the level of precursor transport.

  2008influential reference
• Effect of 21 Different Nitrogen Sources on Global Gene Expression in the Yeast Saccharomyces cerevisiae

  2007influential reference
• Fast and Selective Ammonia Transport by Aquaporin-8*

  2007cited by this paper
• The Role of Yeasts in Grape Flavor Development during Fermentation: The Example of Sauvignon blanc

  2006cited by this paper
• Effect of low temperature fermentation and nitrogen content on wine yeast metabolism

  2006cited by this paper
• Bioinformatics and Computational Biology Solutions Using R and Bioconductor

  2006cited by this paper
• limma: Linear Models for Microarray Data

  2005cited by this paper
• Use of within-array replicate spots for assessing differential expression in microarray experiments

  2005cited by this paper
• A homozygous diploid subset of commercial wine yeast strains

  2005cited by this paper
• Influence of the timing of nitrogen additions during synthetic grape must fermentations on fermentation kinetics and nitrogen consumption.

  2005influential reference
• Implications of nitrogen nutrition for grapes, fermentation and wine

  2005cited by this paper
• Bioinformatics and Computational Biology Solutions Using R and Bioconductor (Statistics for Biology and Health)

  2005cited by this paper
• Genomic analysis of stationary-phase and exit in Saccharomyces cerevisiae: gene expression and identification of novel essential genes.

  2004cited by this paper
• Linear Models and Empirical Bayes Methods for Assessing Differential Expression in Microarray Experiments

  2004cited by this paper
• Nitrogen catabolite repression in Saccharomyces cerevisiae during wine fermentations.

  2004influential reference
• Bioconductor: open software development for computational biology and bioinformatics

  2004cited by this paper
• Transcriptional profiling of wine yeast in fermenting grape juice: regulatory effect of diammonium phosphate.

  2003cited by this paper
• Genome‐wide monitoring of wine yeast gene expression during alcoholic fermentation

  2003influential reference
• GDH1 expression is regulated by GLN3, GCN4, and HAP4 under respiratory growth.

  2002cited by this paper
• Transmitting the signal of excess nitrogen in Saccharomyces cerevisiae from the Tor proteins to the GATA factors: connecting the dots.

  2002influential reference
• Functional profiling of the Saccharomyces cerevisiae genome

  2002cited by this paper
• Nitrogen regulation in Saccharomyces cerevisiae.

  2002influential reference
• Saccharomyces cerevisiae Σ1278b Has Novel Genes of the N-Acetyltransferase Gene Superfamily Required for l-Proline Analogue Resistance

  2000cited by this paper
• The TOR signalling pathway controls nuclear localization of nutrient-regulated transcription factors

  1999cited by this paper
• Nitrogen catabolite repression in Saccharomyces cerevisiae

  1999cited by this paper
• Amino Acid Signaling in Saccharomyces cerevisiae: a Permease-Like Sensor of External Amino Acids and F-Box Protein Grr1p Are Required for Transcriptional Induction of the AGP1 Gene, Which Encodes a Broad-Specificity Amino Acid Permease

  1999cited by this paper
• Identification of new volatile thiols in the aroma of Vitis vinifera L. var. Sauvignon blanc wines

  1998cited by this paper
• Development of a method for analyzing the volatile thiols involved in the characteristic aroma of wines made from vitis vinifera l. Cv. Sauvignon blanc

  1998cited by this paper
• Improvement of Nitrogen Assimilation and Fermentation Kinetics under Enological Conditions by Derepression of Alternative Nitrogen-Assimilatory Pathways in an Industrial Saccharomyces cerevisiae Strain

  1998cited by this paper
• Cross regulation of four GATA factors that control nitrogen catabolic gene expression in Saccharomyces cerevisiae

  1997cited by this paper
• Copyright © 1997, American Society for Microbiology A Family of Ammonium Transporters in

  1997influential reference
• Role of GATA factor Nil2p in nitrogen regulation of gene expression in Saccharomyces cerevisiae

  1997influential reference
• Interaction of the GATA factor Gln3p with the nitrogen regulator Ure2p in Saccharomyces cerevisiae

  1996cited by this paper
• Controlling the false discovery rate: a practical and powerful approach to multiple testing

  1995influential reference
• Amino Acid and Ammonium Utilization by Saccharomyces cerevisiae Wine Yeasts From a Chemically Defined Medium

  1995cited by this paper
• Identification of a powerful aromatic component of Vitis vinifera L. var. sauvignon wines: 4‐mercapto‐4‐methylpentan‐2‐one

  1995cited by this paper
• Role of the GATA factors Gln3p and Nil1p of Saccharomyces cerevisiae in the expression of nitrogen-regulated genes.

  1995cited by this paper
• Preparation of Yeast RNA

  1993cited by this paper
• Effect of Sugar Transport Inactivation in Saccharomyces cerevisiae on Sluggish and Stuck Enological Fermentations

  1989cited by this paper
• Regulation of nitrogen assimilation in Saccharomyces cerevisiae: roles of the URE2 and GLN3 genes

  1988cited by this paper

• The Addition of Glutamine Enhances the Quality of Huangjiu by Modifying the Assembly and Metabolic Activities of Microorganisms during the Fermentation Process

  2024cites this paper
• Yeast Bioflavoring in Beer: Complexity Decoded and Built up Again

  2024cites this paper
• The Effect of Yeast Inoculation Methods on the Metabolite Composition of Sauvignon Blanc Wines

  2023cites this paper
• Fermentative Production of Volatile Metabolites Using Brettanomyces bruxellensis from Fruit and Vegetable By-Products

  2022cites this paper
• Effect of Unsaturated Fatty Acids on Intra-Metabolites and Aroma Compounds of Saccharomyces cerevisiae in Wine Fermentation

  2021cites this paper
• Mechanisms of Metabolic Adaptation in Wine Yeasts: Role of Gln3 Transcription Factor

  2021cites this paper
• Saccharomyces cerevisiae nutrient signaling pathways show an unexpected early activation pattern during winemaking

  2020cites this paper
• fermentation

  2020cites this paper
• Comparing the Effects of Different Unsaturated Fatty Acids on Fermentation Performance of Saccharomyces cerevisiae and Aroma Compounds during Red Wine Fermentation

  2019cites this paper
• Controlling sugarcane press-mud fermentation to increase bioethanol steam reforming for hydrogen production.

  2019cites this paper
• Effects on varietal aromas during wine making: a review of the impact of varietal aromas on the flavor of wine

  2019cites this paper
• Application of Protein Hydrolysates from Defatted Walnut Meal in High-Gravity Brewing to Improve Fermentation Performance of Lager Yeast

  2019cites this paper
• Transcriptional Comparison Investigating the Influence of the Addition of Unsaturated Fatty Acids on Aroma Compounds During Alcoholic Fermentation

  2019cites this paper
• Utilization of prickly pear waste for baker's yeast production

  2019cites this paper
• Effects of diammonia phosphate addition on the chemical constituents in lychee wine fermented with Saccharomyces cerevisiae

  2019cites this paper
• Analysis of the NCR Mechanisms in Hanseniaspora vineae and Saccharomyces cerevisiae During Winemaking

  2019cites this paper
• Effect of the addition of branched‐chain amino acids to non‐limited nitrogen synthetic grape must on volatile compounds and global gene expression during alcoholic fermentation

  2018cites this paper
• Conditions promoting effective very high gravity sugarcane juice fermentation

  2018influential citation
• The content of linoleic acid in grape must influences the aromatic effect of branched-chain amino acids addition on red wine.

  2018cites this paper
• Use of Earthworm (Eisenia foetida) Flour and Hydrolyzed Chicken Feathers as Sources of Nitrogen and Minerals for Ethanol Production

  2018cites this paper
• Stimulation of d- and l-lactate dehydrogenases transcriptional levels in presence of diammonium hydrogen phosphate resulting to enhanced lactic acid production by Lactobacillus strain.

  2017cites this paper
• Bioethanol Production from Cachaza as Hydrogen Feedstock: Effect of Ammonium Sulfate during Fermentation

  2017cites this paper
• The role of nitrogen uptake on the competition ability of three vineyard Saccharomyces cerevisiae strains.

  2017cites this paper
• Diammonium phosphate stimulates transcription of L-lactate dehydrogenase leading to increased L-lactate production in the thermotolerant Bacillus coagulans strain

  2016cites this paper
• Constitutive expression of the DUR1,2 gene in an industrial yeast strain to minimize ethyl carbamate production during Chinese rice wine fermentation.

  2016cites this paper
• Yeast genes required for conversion of grape precursors to varietal thiols in wine.

  2015cites this paper
• Bioengineering yeast to enhance folate levels in wine

  2015cites this paper
• Yeast fermentation of sorghum worts : influence of nitrogen sources

  2015cites this paper
• The IRC7 gene encodes cysteine desulphydrase activity and confers on yeast the ability to grow on cysteine as a nitrogen source

  2015cites this paper
• Evolution of Volatile Sulfur Compounds during Wine Fermentation.

  2015cites this paper
• Transcriptional response of Saccharomyces cerevisiae to low temperature during wine fermentation

  2015influential citation
• Amino Acid Permeases and their Infl uence on Flavour Compounds in Beer

  2014cites this paper
• Nitrogen and carbon assimilation by Saccharomyces cerevisiae during Sauvignon blanc juice fermentation.

  2014cites this paper
• MET2 affects production of hydrogen sulfide during wine fermentation

  2014cites this paper
• Genes involved in thiol release from cysteine and glutathione conjugates by Saccharomyces cerevisiae during wine fermentation

  2014influential citation
• CAGCAACATTTATAAGAAACAAAAAAAAGAAATAAAAAATGTCTAAAGGTGAAGAATT TAAAAAATAAAGTCTTTTTTTGTCGTTGTTCGATTCACTAGTGGATCTGATATCATC TCAGTTTGG CAGATTAGT CTACATCTTGTGATATAAAACATCAACAAAGACGAGAATGTCTAAAGGTGAAGAATT GATCACTACTGGTAAGAGAATAAATTGGGATTTTTATCTAGTGGATCTGATATCATC TTCGATG AATGCATG ATGGTGTT TTCTCAA TTGCTGTTG GGA

  2013cites this paper
• Biomarkers for detecting nitrogen deficiency during alcoholic fermentation in different commercial wine yeast strains.

  2013cites this paper
• Nitrogen regulation involved in the accumulation of urea in Saccharomyces cerevisiae

  2013cites this paper
• New precursor of 3-mercaptohexan-1-ol in grape juice: thiol-forming potential and kinetics during early stages of must fermentation.

  2013cites this paper
• Effects of Lys and His supplementations on the regulation of nitrogen metabolism in lager yeast

  2013cites this paper
• Enhancement of volatile thiol release of Saccharomyces cerevisiae strains using molecular breeding

  2013influential citation
• Effect of low temperature on Sauvignon blanc fermentation by Saccharomyces cerevisiae

  2013cites this paper
• Functional improvement of Saccharomyces cerevisiae to reduce volatile acidity in wine.

  2013cites this paper
• The Fermentation Stress Response Protein Aaf1p/Yml081Wp Regulates Acetate Production in Saccharomyces cerevisiae

  2012cites this paper
• Yeast genes involved in sulfur and nitrogen metabolism affect the production of volatile thiols from Sauvignon Blanc musts

  2012cites this paper
• Researching the mechanisms of PHO3 gene regulation depending on the nitrogen source in medium in yeast Saccharomyces cerevisiae

  2012cites this paper
• TheSaccharomyces cerevisiae fermentation stress responseprotein Igd 1 p / Yfr 017 p regulatesglycogen levels by inhibiting theglycogen debranching enzyme

  2011cites this paper
• The Saccharomyces cerevisiae fermentation stress response protein Igd1p/Yfr017p regulates glycogen levels by inhibiting the glycogen debranching enzyme.

  2011cites this paper