Recent advance in the study of caspase-like proteases and Bax inhibitor-1 in plants: their possible roles as regulator of programmed cell death.

No abstract is available for this paper.

• Publication year

  2004

• Venue

  Molecular plant pathology

• Publication date

  Unknown publication date

• Fields of study

  Biology, Medicine, Environmental Science

• Identifiers
  DOI 10.1111/j.1364-3703.2004.00206.xPMID 20565583
• External record

  Open on Semantic Scholar

• Source metadata

  Semantic Scholar, PubMed

• No claims are published for this paper.

• No concepts are published for this paper.

• A tomato metacaspase gene is upregulated during programmed cell death in Botrytis cinerea-infected leaves

  2003cited by this paper
• Establishment of biotrophy by parasitic fungi and reprogramming of host cells for disease resistance.

  2003cited by this paper
• Expression of the baculovirus p35 protein in tobacco affects cell death progression and compromises N gene-mediated disease resistance response to Tobacco mosaic virus.

  2003cited by this paper
• Multiple mediators of plant programmed cell death: Interplay of conserved cell death mechanisms and plant‐specific regulators

  2003cited by this paper
• Defining senescence and death.

  2003cited by this paper
• Overexpression of barley BAX inhibitor 1 induces breakdown of mlo-mediated penetration resistance to Blumeria graminis

  2003cited by this paper
• Apoptosis—an introduction

  2003cited by this paper
• Overexpression of Bax inhibitor suppresses the fungal elicitor-induced cell death in rice (Oryza sativa L) cells.

  2003cited by this paper
• Mechanisms of caspase activation and inhibition during apoptosis.

  2002cited by this paper
• Calmodulin interacts with MLO protein to regulate defence against mildew in barley

  2002cited by this paper
• Origin and evolution of eukaryotic apoptosis: the bacterial connection

  2002cited by this paper
• Do Plant Caspases Exist?

  2002cited by this paper
• Apoptosis in yeast: a new model system with applications in cell biology and medicine

  2002cited by this paper
• Developmental programmed cell death in plants.

  2002cited by this paper
• Antisense down regulation of NtBI‐1 in tobacco BY‐2 cells induces accelerated cell death upon carbon starvation

  2002cited by this paper
• Molecular characterization of two plant BI-1 homologues which suppress Bax-induced apoptosis in human 293 cells

  2002cited by this paper
• Yeast and apoptosis

  2002cited by this paper
• Expression of the antiapoptotic baculovirus p35 gene in tomato blocks programmed cell death and provides broad-spectrum resistance to disease

  2002cited by this paper
• A metacaspase of Trypanosoma brucei causes loss of respiration competence and clonal death in the yeast Saccharomyces cerevisiae

  2002cited by this paper
• Application of gene silencing in plants.

  2002cited by this paper
• A caspase-related protease regulates apoptosis in yeast.

  2002cited by this paper
• Abrogation of disease development in plants expressing animal antiapoptotic genes

  2001cited by this paper
• Programmed cell death, mitochondria and the plant hypersensitive response

  2001cited by this paper
• Mammalian Bax-induced plant cell death can be down-regulated by overexpression of Arabidopsis Bax Inhibitor-1 (AtBI-1)

  2001cited by this paper
• Caspases: more than just killers?

  2001cited by this paper
• Arabidopsis gene knockout: phenotypes wanted.

  2001cited by this paper
• Differential expression of putative cell death regulator genes in near-isogenic, resistant and susceptible barley lines during interaction with the powdery mildew fungus

  2001cited by this paper
• Regulation and execution of programmed cell death in response to pathogens, stress and developmental cues.

  2001cited by this paper
• Identification of paracaspases and metacaspases: two ancient families of caspase-like proteins, one of which plays a key role in MALT lymphoma.

  2000cited by this paper
• AtBI-1, a plant homologue of Bax inhibitor-1, suppresses Bax-induced cell death in yeast and is rapidly upregulated during wounding and pathogen challenge.

  2000cited by this paper
• Programmed Death in Bacteria

  2000cited by this paper
• Programmed cell death in cell cultures

  2000cited by this paper
• Ozone: a tool for probing programmed cell death in plants

  2000cited by this paper
• Caspase-like protease involvement in the control of plant cell death

  2000cited by this paper
• Bax-induced cell death in tobacco is similar to the hypersensitive response.

  1999cited by this paper
• Caspase activation: the induced-proximity model.

  1999cited by this paper
• Die and let live - programmed cell death in plants.

  1999cited by this paper
• The domains of death: evolution of the apoptosis machinery.

  1999cited by this paper
• Evolutionally conserved plant homologue of the Bax Inhibitor‐1 (BI‐1) gene capable of suppressing Bax‐induced cell death in yeast 1

  1999cited by this paper
• Animal cell-death suppressors Bcl-x(L) and Ced-9 inhibit cell death in tobacco plants.

  1999cited by this paper
• Programmed cell death in plant disease: the purpose and promise of cellular suicide.

  1998cited by this paper
• UV‐C radiation induces apoptotic‐like changes in Arabidopsis thaliana

  1998cited by this paper
• Caspases: enemies within.

  1998cited by this paper
• Bax inhibitor-1, a mammalian apoptosis suppressor identified by functional screening in yeast.

  1998cited by this paper
• Bcl-2 family proteins

  1998cited by this paper
• A novel zinc finger protein is encoded by the Arabidopsis LSD1 gene and functions as a negative regulator of plant cell death.

  1997cited by this paper
• Programmed Cell Death in Plants.

  1997cited by this paper
• Chromatin fragmentation associated with apoptotic changes in tobacco cells exposed to cold stress

  1997cited by this paper
• Mechanisms and genes of cellular suicide

  1995cited by this paper
• Mechanisms and functions of cell death.

  1991cited by this paper

• Genome-Wide Identification of Bax Inhibitor (BI) Gene in Potato (Solanum tuberosum) and Response During Begomovirus Infection

  2025cites this paper
• WRKY47 transcription factor modulates leaf senescence through regulating PCD-associated genes in Arabidopsis.

  2024cites this paper
• Nonspecific Permeability Pore (mPTP) in Plant Mitochondria and Its Role in Cell Death

  2023cites this paper
• Nonspecific permeability time (mPTP) in plant mitochondria and its role in cell death

  2023cites this paper
• Genome-Wide Identification of the NAC Gene Family in Zanthoxylum bungeanum and Their Transcriptional Responses to Drought Stress

  2022cites this paper
• Response of the legume Macrotyloma axillare ‘Java’ to different inoculum levels of Meloidogyne javanica and defence responses

  2022cites this paper
• Identification of a Putative BAX inhibitor in Toxoplasma gondii (TgBI-1)

  2022cites this paper
• Genome-wide association of the metabolic shifts underpinning dark-induced senescence in Arabidopsis

  2021cites this paper
• The Arabidopsis SMC6A and SMC6B have redundant function in seed and gametophyte development.

  2021cites this paper
• Antagonistic potential and histopathology of Meloidogyne javanica on Macrotyloma axillare cv. Java

  2020cites this paper
• The tale of caspase homologues and their evolutionary outlook: deciphering programmed cell death in cyanobacteria

  2020cites this paper
• Vacuolar processing enzyme translocates to the vacuole through the autophagy pathway to induce programmed cell death

  2019cites this paper
• The AtMC4 regulates the stem cell homeostasis in Arabidopsis by catalyzing the cleavage of AtLa1 protein in response to environmental hazards.

  2018cites this paper
• Regeneration and Transformation of Selected Kenyan Groundnut (Arachis Hypogaea L.) Genotypes with Isopentenyl Transferase (IPT) Gene Towards Drought Tolerance

  2018cites this paper
• Domain swap between two type-II metacaspases defines key elements for their biochemical properties.

  2018cites this paper
• Antagonistic Effects of Java against Plant Parasitic Nematodes

  2018cites this paper
• Vacuolar processing enzyme (VvβVPE) from Vitis vinifera, processes seed proteins during ovule development, and accelerates seed germination in VvβVPE heterologously over-expressed Arabidopsis.

  2018cites this paper
• Expression of Arabidopsis Bax Inhibitor‐1 in transgenic sugarcane confers drought tolerance

  2016cites this paper
• Genetic analysis of arabidopsis metacaspases as regulators of responses to DNA damage in root stem cells

  2016cites this paper
• Dying with Style: Death Decision in Plant Embryogenesis.

  2016cites this paper
• Proteome Characterization of Leaves in Common Bean

  2015influential citation
• Progress in genetic engineering of peanut (Arachis hypogaea L.)--a review.

  2015cites this paper
• Analysis of Stress Responsive Genes in Capsicum for Salinity Responses

  2015cites this paper
• Programmed cell death in plants: A chloroplastic connection

  2015cites this paper
• Stress-Responsive Expression, Subcellular Localization and Protein–Protein Interactions of the Rice Metacaspase Family

  2015cites this paper
• Different profile of transcriptome between wheat Yunong 201 and its high-yield mutant Yunong 3114

  2014cites this paper
• Identification of Differentially Expressed Genes by
cDNA-AFLP Technique in Response to Drought Stress
in Triticum durum.

  2014cites this paper
• CAGCTGCTGACTGAGATGGA TCTCATGGTTGGTCTCGATG CGCTGTTCCGTAGACATGAA AACAGAGACCGAATCAAGCA CGAATACGAACCGTGAAAGC ATGAAACAAAAGGCCCTCAA CTGGTGGCGTAAGACCATTT CACCTTCACCAGGCCTATTC GACAAGTGCAGGACCGATTC AGGTTACCGAACTCCCTGCT CTGTTTGTTGGCACCTCTGA ATCGAGCAAAACACAGCACA ATGTCTGGCCTGTTGGTAGC GGATGGTGGTGACGATCTCT GACGGT

  2014cites this paper
• Caractérisation de suppresseurs de la mort cellulaire programmée chez Arabidopsis thaliana

  2014cites this paper
• Plant-Pathogen Interactions Associated with Wasting Disease in the Tropical Seagrass Thalassia testudinum.

  2013cites this paper
• Expression analysis of the metacaspase gene family in Arabidopsis

  2013cites this paper
• Transcriptome-Wide Mapping of Pea Seed Ageing Reveals a Pivotal Role for Genes Related to Oxidative Stress and Programmed Cell Death

  2013cites this paper
• The metacaspase gene family of Vitis vinifera L.: characterization and differential expression during ovule abortion in stenospermocarpic seedless grapes.

  2013cites this paper
• UDP-glucose pyrophosphorylase is a novel plant cell death regulator.

  2013cites this paper
• BAX inhibitor-1 silencing suppresses white spot syndrome virus replication in red swamp crayfish, Procambarus clarkii.

  2013cites this paper
• Programmed cell death of secretory cavity cells in fruits of Citrus grandis cv. Tomentosa is associated with activation of caspase 3-like protease

  2012cites this paper
• Low levels of Bax inhibitor-1 gene expression increase tunicamycin-induced apoptosis in human neuroblastoma SY5Y cells

  2012cites this paper
• Application of Non-invasive Microelectrode Flux Measurements in Plant Stress Physiology

  2012cites this paper
• Regulating the reapers: activating metacaspases for programmed cell death.

  2012cites this paper
• Release of Apical Dominance in Potato Tuber Is Accompanied by Programmed Cell Death in the Apical Bud Meristem[C][W]

  2012influential citation
• Genômica funcional da interação cacaueiro (Theobroma cacao L.) x Moniliophthora perniciosa por meio do sistema modelo Micro-Tom (Solanum lycopersicum L)

  2012cites this paper
• Molecular cloning and phylogenetic analysis of cereal type II metacaspase cDNA from wheat

  2011cites this paper
• Review/ Derleme Evidences for the presence of caspase-like activities in plants

  2011cites this paper
• Exploring The Source Of Plant Nb-Lrr Disease Resistance Protein Signaling: Roles Of Cc And Nb Domains In Pathogen Perception And Defense Induction

  2011cites this paper
• Calcium-dependent Activation and Autolysis of Arabidopsis Metacaspase 2d*

  2011cites this paper
• Arabidopsis metacaspase 2d is a positive mediator of cell death induced during biotic and abiotic stresses.

  2011influential citation
• The Botanical Dance of Death: Programmed Cell Death in Plants

  2011cites this paper
• The Cladosporium fulvum Avr2 protein behaves both as a virulence and an avirulence factor

  2010cites this paper
• Responses to DNA damage within Arabidopsis stem cell niches

  2010cites this paper
• Crible de mutants de la mort cellulaire programmée chez Arabidopsis thaliana

  2010cites this paper
• Apoptotic-like regulation of programmed cell death in plants

  2010cites this paper
• Bax Inhibitor-1, a Conserved Cell Death Suppressor, Is a Key Molecular Switch Downstream from a Variety of Biotic and Abiotic Stress Signals in Plants

  2009cites this paper
• Plant oxylipins: role of jasmonic acid during programmed cell death, defence and leaf senescence

  2009cites this paper
• Programmed Cell Death in Plants: Apoptotic but Not Quite

  2009influential citation
• Implications of OEP16 protein in the photoprotection of Arabidopsis thaliana during light stress

  2009cites this paper
• Antifungal Defenses of Seagrasses from the Indian River Lagoon, Florida

  2008cites this paper
• Reactive Oxygen Species Metabolism in Plants: Production, Detoxification and Signaling in the Stress Response

  2008cites this paper
• Proteases and protease inhibitors involved in plant stress response and acclimation

  2008cites this paper
• Arabidopsis bax inhibitor-1

  2008cites this paper
• Roles of Plant Proteases in Pathogen Defense

  2008cites this paper
• Programmed Cell Death in Dinoflagellates

  2008cites this paper
• Proteolytic Enzymes in Plant Programmed Cell Death

  2008cites this paper
• Programmed Cell Death in Plants: Orchestrating an Intrinsic Suicide Program Within Walls

  2008influential citation
• Apoptotic-like programmed cell death in plants.

  2008cites this paper
• BAX Inhibitor-1 Modulates Endoplasmic Reticulum Stress-mediated Programmed Cell Death in Arabidopsis*

  2008cites this paper
• Self-incompatibility in Papaver: signalling to trigger PCD in incompatible pollen.

  2008cites this paper
• Kunitz trypsin inhibitor: an antagonist of cell death triggered by phytopathogens and fumonisin b1 in Arabidopsis.

  2008influential citation
• The hypersensitive response; the centenary is upon us but how much do we know?

  2008cites this paper
• A role for actin in regulating apoptosis/programmed cell death: evidence spanning yeast, plants and animals.

  2008cites this paper
• Expression of animal CED-9 anti-apoptotic gene in tobacco modifies plasma membrane ion fluxes in response to salinity and oxidative stress

  2007cites this paper
• Plant mitochondrial pathway leading to programmed cell death

  2007cites this paper
• Modulation of Bax Inhibitor-1 and cytosolic Ca2+ by cytokinins in Nicotiana tabacum cells.

  2007cites this paper
• Inducible cell death in plant immunity.

  2007cites this paper
• Caspase-like proteases and their role in programmed cell death in plants

  2007cites this paper
• Expression of a metacaspase gene of Nicotiana benthamiana after inoculation with Colletotrichum destructivum or Pseudomonas syringae pv. tomato, and the effect of silencing the gene on the host response

  2007cites this paper
• Bcl-xL transformed peanut (Arachis hypogaea L.) exhibits paraquat tolerance

  2007cites this paper
• Participation of proteolytic enzymes in the interaction of plants with phytopathogenic microorganisms

  2006cites this paper
• Arabidopsis Bax inhibitor-1 functions as an attenuator of biotic and abiotic types of cell death.

  2006cites this paper
• Analise bioquimica e funcional do gene bax inibidor 1 isolado da interaçâo entre Theobroma cacao E Crinipellis perniciosa

  2006cites this paper
• Role of Polyamines in Apoptosis and Other Recent Advances in Plant Polyamines

  2005cites this paper
• Caspases. Regulating Death Since the Origin of Life1

  2005cites this paper
• Chemical- and Pathogen-Induced Programmed Cell Death in Plants

  2005cites this paper
• H 2 O 2 - or NO-induced programmed death of soybean suspension cell cultures

  2005cites this paper
• Gene Trap Lines Define Domains of Gene Regulation in Arabidopsis Petals and Stamensw⃞

  2005cites this paper
• Ozone-Induced Programmed Cell Death in the Arabidopsis radical-induced cell death1 Mutant1

  2005cites this paper
• The colors of autumn leaves as symptoms of cellular recycling and defenses against environmental stresses.

  2005cites this paper
• Vacuolar proteases livening up programmed cell death.

  2005cites this paper
• Involvement of the mitochondrial K(+)ATP channel in H2O2- or NO-induced programmed death of soybean suspension cell cultures.

  2005cites this paper
• Update on Plant Caspases Caspases. Regulating Death Since the Origin of Life

  2005cites this paper
• Two Arabidopsis Metacaspases AtMCP1b and AtMCP2b Are Arginine/Lysine-specific Cysteine Proteases and Activate Apoptosis-like Cell Death in Yeast*

  2005cites this paper
• Imaging plant cell death: GFP-Nit1 aggregation marks an early step of wound and herbicide induced cell death

  2005cites this paper
• Death by proteases in plants: Whodunit

  2005cites this paper
• Programmed cell death in plant embryogenesis.

  2005cites this paper
• A search for developmental gene sequences in the genomes of filamentous fungi

  2005cites this paper
• Apoptosis in yeast.

  2004cites this paper
• The plant proteolytic machinery and its role in defence.

  2004cites this paper
• Induction of programmed cell death in lily by the fungal pathogen Botrytis elliptica.

  2004cites this paper