pGOODs: new plasmids for the co-expression of proteins in Escherichia coli

No abstract is available for this paper.

• Publication year

  2011

• Venue

  Biotechnology Letters

• Publication date

  2011-04-23

• Fields of study

  Biology, Medicine

• Identifiers
  DOI 10.1007/s10529-011-0624-6PMID 21516313
• External record

  Open on Semantic Scholar

• Source metadata

  Semantic Scholar, PubMed

• No claims are published for this paper.

• No concepts are published for this paper.

• Over-producing soluble protein complex and validating protein-protein interaction through a new bacterial co-expression system.

  2010influential reference
• Proteolysis of the proofreading subunit controls the assembly of Escherichia coli DNA polymerase III catalytic core.

  2009influential reference
• Development of expression vectors for Escherichia coli based on the pCR2 replicon

  2007influential reference
• A novel high-copy plasmid, pEC, compatible with commonly used Escherichia coli cloning and expression vectors

  2007cited by this paper
• Environmental and genetic factors affecting mutability to aminoglycoside antibiotics among Escherichia coli K12 strains

  2003cited by this paper
• Hydrolysis of the 5'-p-nitrophenyl ester of TMP by the proofreading exonuclease (epsilon) subunit of Escherichia coli DNA polymerase III.

  2002cited by this paper
• Hydrolysis of the 5'- p -Nitrophenyl Ester of TMP by the Proofreading Exonuclease (ε) Subunit of Escherichia coli DNA Polymerase III

  2002cited by this paper
• Molecular Cloning: A Laboratory Manual

  2001cited by this paper
• A bacterial two-hybrid selection system for studying protein-DNA and protein-protein interactions.

  2000cited by this paper
• A bacterial two-hybrid system based on a reconstituted signal transduction pathway.

  1998cited by this paper
• Mutants in the Exo I motif of Escherichia coli dnaQ: defective proofreading and inviability due to error catastrophe.

  1996influential reference
• Probing the interaction between single molecules: fluorescence resonance energy transfer between a single donor and a single acceptor

  1996cited by this paper
• Tight regulation, modulation, and high-level expression by vectors containing the arabinose PBAD promoter

  1995influential reference
• Quality and position of the three lac operators of E. coli define efficiency of repression.

  1994influential reference
• A novel genetic system to detect protein–protein interactions

  1989cited by this paper
• Multicopy expression vector based on temperature-regulated lac repressor: expression of human immunodeficiency virus env gene in Escherichia coli.

  1988influential reference
• Effects of segregation and selection on instability of plasmid pACYC184 in Escherichia coli B

  1987cited by this paper
• The interaction of the recognition helix of lac repressor with lac operator.

  1987cited by this paper
• Escherichia coli

  1983cited by this paper
• Energy transfer: a spectroscopic ruler.

  1967cited by this paper

• Proteome Dynamics during Antibiotic Persistence and Resuscitation

  2021cites this paper
• Proteome dynamics in persisting and resuscitating bacterial cells

  2020cites this paper
• Correction: Escherichia coli DnaE Polymerase Couples Pyrophosphatase Activity to DNA Replication

  2016cites this paper
• Escherichia coli DnaE Polymerase Couples Pyrophosphatase Activity to DNA Replication

  2016cites this paper
• Construction of a compatible Gateway-based co-expression vector set for expressing multiprotein complexes in E. coli.

  2016cites this paper
• The multifaceted benefits of protein co-expression in Escherichia coli.

  2015cites this paper
• Seamless stitching of biosynthetic gene cluster containing type I polyketide synthases using Red/ET mediated recombination for construction of stably co-existing plasmids.

  2015cites this paper
• Simultaneous ternary extension of DNA catalyzed by a trimeric replicase assembled in vivo.

  2015cites this paper
• GTTAAGGGATTTTG TTCTAAATACATTCAAATATGTATCCGCTCATGAATTAATTC ATGAG CTCAGCCAATCGA AGTTTATCACAGTTAAATTGCTAACGCAGTCAGGCACCGTGT CGA TCCCGCGAAATTAAT TTGGAGTGGTGAATCCGTTAGCGAGGTGCCGCCGGCTTCCAT CA AAAAACCCCTCAAGAC AGTCTAGATTAATTAAGAAGGAGATATACATATGCCGGGTGTTTTAGGG TTCTGCAGTCGCCATCAGCGCCTGTG AACTGCAGAAAGTACTGCC

  2014cites this paper
• Expanding the landscape of recombinant protein production in Escherichia coli

  2013cites this paper
• Continuous enzyme-coupled assay of phosphate- or pyrophosphate-releasing enzymes.

  2012cites this paper