Diurnal-and sex-related difference of metallothionein expression in mice

Background Metallothionein (MT) is a small, cysteine-rich, metal-binding protein that plays an important role in protecting against toxicity of heavy metal and chemicals. This study was aimed to define diurnal and sex variation of MT in mice. Methods Adult mice were maintained in light- and temperature-controlled facilities for 2 weeks with light on at 8:00 and light off at 20:00. The blood, liver, and kidneys were collected every 4 h during the 24 h period. Total RNA was isolated, purified, and subjected to real-time RT-PCR analysis and MT protein was determined by western blot and the Cd/hemoglobin assay. Results The diurnal variations in mRNA levels of MT-1 and MT-2in liver were dramatic, up to a 40-foldpeak/trough ratio. MT mRNA levels in kidneys and blood also showed diurnal variation, up to 5-fold peak/trough ratio. The diurnal variation of MT mRNAs resembled the clock gene albumin site D-binding protein (Dbp), and was anti-phase to the clock gene Brain and Muscle ARNT-like Protein 1 (Bmal1) in liver and kidneys. The peaks of MT mRNA levels were higher in females than in males. Hepatic MT protein followed a similar pattern, with about a 3-fold difference. Conclusion MT mRNA levels and protein showed diurnal- and sex-variation in liver, kidney, and blood of mice, which could impact the body defense against toxic stimuli.

• Publication year

  2012

• Venue

  Journal of Circadian Rhythms

• Publication date

  2012-07-24

• Fields of study

  Biology, Medicine, Environmental Science

• Identifiers
  DOI 10.1186/1740-3391-10-5PMID 22827964PMCID 3585924
• External record

  Open on Semantic Scholar

• Source metadata

  Semantic Scholar, PubMed

• No claims are published for this paper.

• No concepts are published for this paper.

• Evaluation of factors associated with cadmium exposure and kidney function in the general population

  2013cited by this paper
• Diurnal variation of cadmium-induced mortality in mice.

  2012cited by this paper
• Evaluation of alpha-methylacyl-CoA racemase, metallothionein and prostate specific antigen as prostate cancer prognostic markers.

  2012cited by this paper
• Diurnal Variation of Hepatic Antioxidant Gene Expression in Mice

  2012cited by this paper
• Evaluation of hepatotoxicity potential of cinnabar-containing An-Gong-Niu-Huang Wan, a patent traditional Chinese medicine.

  2011cited by this paper
• A Review of Metallothionein Isoforms and their Role in Pathophysiology

  2011cited by this paper
• Electrophoretic fingerprint metallothionein analysis as a potential prostate cancer biomarker

  2011cited by this paper
• The mammalian circadian timing system: organization and coordination of central and peripheral clocks.

  2010cited by this paper
• A circadian clock regulates sensitivity to cadmium in Paramecium tetraurelia

  2010cited by this paper
• Serum metallothionein in newly diagnosed patients with childhood solid tumours.

  2010cited by this paper
• Circadian timing in cancer treatments.

  2010cited by this paper
• [Effects of metallothionein on rifampicin (RFP)-induced hepatotoxicity in mice].

  2010cited by this paper
• Metallothionein I Isoform mRNA Expression in Peripheral Lymphocytes as a Biomarker for Occupational Cadmium Exposure

  2009cited by this paper
• Circadian Expression Profiles of Drug-Processing Genes and Transcription Factors in Mouse Liver

  2009cited by this paper
• Metallothionein protection of cadmium toxicity.

  2009cited by this paper
• Downregulated expression of metallothionein and its clinicopathological significance in hepatocellular carcinoma

  2007cited by this paper
• Blood Metallothionein Transcript as a Biomarker for Metal Sensitivity: Low Blood Metallothionein Transcripts in Arsenicosis Patients from Guizhou, China

  2007cited by this paper
• Procedures for numerical analysis of circadian rhythms

  2007cited by this paper
• Antioxidant defense against anthracycline cardiotoxicity by metallothionein

  2007cited by this paper
• Characterizing a Mammalian Circannual Pacemaker

  2006cited by this paper
• Metallothionein expression in hepatocellular carcinoma.

  2002cited by this paper
• Lymphocyte metallothionein-mRNA as a sensitive biomarker of cadmium exposure.

  2001cited by this paper
• Metallothionein-I/II null mice are more sensitive than wild-type mice to the hepatotoxic and nephrotoxic effects of chronic oral or injected inorganic arsenicals.

  2000cited by this paper
• Metallothionein: an intracellular protein to protect against cadmium toxicity.

  1999influential reference
• Health effects of cadmium exposure--a review of the literature and a risk estimate.

  1998cited by this paper
• Cancer registries in environmental cancer epidemiology.

  1998cited by this paper
• Health effects of cadmium exposure - a review of the literature and a risk estimate

  1998cited by this paper
• Circadian clock-controlled genes isolated from Neurospora crassa are late night- to early morning-specific.

  1996cited by this paper
• Overview of metallothionein.

  1991cited by this paper
• [Circadian variations of the mortality of mice due to cadmium sulfate].

  1983cited by this paper
• Tissue distribution of cadmium and metallothionein as a function of time of day and dosage.

  1983cited by this paper
• A CADMIUM PROTEIN FROM EQUINE KIDNEY CORTEX

  1957cited by this paper
• WORLD JOURNAL OF SURGICAL ONCOLOGY

  year unknowncited by this paper

• Microplastic and copper contamination in coastal waters: Accumulation in zooplankton and caged milkfish (Chanos chanos), and metallothionein response in fish.

  2025cites this paper
• Geographic and Sociodemographic Differences in Cadmium Exposure in the Multi-Ethnic Study of Atherosclerosis (MESA)

  2025cites this paper
• Corticosteroid-induced gene expression is attenuated in the hippocampus of mice with model of post-traumatic stress disorder.

  2025cites this paper
• Understanding Neurogenesis and Neuritogenesis via Molecular Insights, Gender Influence, and Therapeutic Implications: Intervention of Nanomaterials.

  2024cites this paper
• LimoRhyde2: Genomic analysis of biological rhythms based on effect sizes

  2023cites this paper
• LimoRhyde2: genomic analysis of biological rhythms based on effect sizes

  2023cites this paper
• Dietary Zinc Differentially Regulates the Effects of the GPR39 Receptor Agonist, TC-G 1008, in the Maximal Electroshock Seizure Test and Pentylenetetrazole-Kindling Model of Epilepsy

  2023cites this paper
• Proximal tubular transport of Metallothionein-Mercury complexes and protection against nephrotoxicity

  2023cites this paper
• Volatile organic compounds and metals/metalloids exposure in children after e-waste control: Implications for priority control pollutants and exposure mitigation measures.

  2023cites this paper
• Metals and Metallothionein Expression in Relation to Progression of Chronic Kidney Disease of Unknown Etiology (CKDu) in Sri Lanka

  2022cites this paper
• Sex‐Based Differences in the Biodistribution of Nanoparticles and Their Effect on Hormonal, Immune, and Metabolic Function

  2022cites this paper
• Ageing-associated effects of a long-term dietary modulation of four trace elements in mice

  2021influential citation
• Sexually Dimorphic Growth Stimulation in a Strain of Growth Hormone Transgenic Coho Salmon (Oncorhynchus kisutch)

  2021cites this paper
• Elevated metallothionein expression in long-lived species mediates the influence of cadmium accumulation on aging

  2021cites this paper
• Metallothioneins and Megalin Expression Profiling in Premalignant and Malignant Oral Squamous Epithelial Lesions

  2021cites this paper
• Circadian Clock Gene Expression and Drug/Toxicant Interactions as Novel Targets of Chronopharmacology and Chronotoxicology

  2018cites this paper
• A Prisma-compliant meta-analysis

  2018cites this paper
• Regulatory Plasticity of Earthworm wMT-2 Gene Expression

  2017cites this paper
• Reverse CATGTACGTAGCCATCC ACCCTCATAGATGGGCACAG CAGTGAACGGGGAAATA TATGCCAAAATAGCCGTCGC TTACATCAGCACGCCTC TACTGCTTGGCTCTTCTGCT GCCCCTCCTGTAATGG AGGTTCGTCAGCTACACACA TGATAGGGAAGTGCACA GTGCCTCAGTTTCTCCTCCT CAACAGCCACGGTTCTC CACAAGCCGTTACATCGAGG GCTACACCACCCCTTAC CAACACTGACACGGCAGAAA TGGTGAAGACATGACGA TG

  2017cites this paper
• Dysregulation of metallothionein and circadian genes in human hepatocellular carcinoma

  2017influential citation
• Repeated manganese administration produced abnormal expression of circadian clock genes in the hypothalamus and liver of rats

  2017cites this paper
• Atorvastatin alters the expression of genes related to bile acid metabolism and circadian clock in livers of mice

  2017cites this paper
• The Tibetan medicine Zuotai influences clock gene expression in the liver of mice

  2016cites this paper
• Ethanol: A simple and effective RNA‐preservation for freshwater insects living in remote habitats

  2016cites this paper
• Redox biology and the interface between bioenergetics, autophagy and circadian control of metabolism.

  2016cites this paper
• Sex Differences in the Circadian Variation of Cytochrome P450 Genes and Corresponding Nuclear Receptors in Mouse Liver

  2013cites this paper