Suppression of cell-cycle progression by Jun dimerization protein-2 (JDP2) involves downregulation of cyclin-A2

We report here a novel role for Jun dimerization protein-2 (JDP2) as a regulator of the progression of normal cells through the cell cycle. To determine the role of JDP2 in vivo, we generated Jdp2-knockout (Jdp2KO) mice by targeting exon-1 to disrupt the site of initiation of transcription. The epidermal thickening of skin from the Jdp2KO mice after treatment with 12-O-tetradecanoylphorbol 13-acetate (TPA) proceeded more rapidly than that of control mice, and more proliferating cells were found at the epidermis. Fibroblasts derived from embryos of Jdp2KO mice proliferated faster and formed more colonies than fibroblasts from wild-type mice. JDP2 was recruited to the promoter of the gene for cyclin-A2 (ccna2) at the AP-1 site. Cells lacking Jdp2 had elevated levels of cyclin-A2 mRNA. Furthermore, reintroduction of JDP2 resulted in the repression of transcription of ccna2 and of cell-cycle progression. Thus, transcription of the gene for cyclin-A2 appears to be a direct target of JDP2 in the suppression of cell proliferation.

• Publication year

  2010

• Venue

  Oncogene

• Publication date

  2010-08-30

• Fields of study

  Biology, Medicine

• Identifiers
  DOI 10.1038/ONC.2010.355PMCID 3007677
• External record

  Open on Semantic Scholar

• Source metadata

  Semantic Scholar

• No claims are published for this paper.

• No concepts are published for this paper.

• Distinct and redundant functions of cyclin E1 and cyclin E2 in development and cancer

  2010cited by this paper
• The AP-1 repressor protein, JDP2, potentiates hepatocellular carcinoma in mice

  2010cited by this paper
• p53 and E2f: partners in life and death

  2009cited by this paper
• Mammalian cell-cycle regulation: several Cdks, numerous cyclins and diverse compensatory mechanisms

  2009cited by this paper
• Activation of alternative Jdp2 promoters and functional protein isoforms in T-cell lymphomas by retroviral insertion mutagenesis

  2009cited by this paper
• Degradation of cyclin A is regulated by acetylation

  2009cited by this paper
• Cyclin A is redundant in fibroblasts but essential in hematopoietic and embryonic stem cells.

  2009cited by this paper
• The ubiquitously expressed bZIP inhibitor, JDP2, suppresses the transcription of its homologue immediate early gene counterpart, ATF3

  2009cited by this paper
• Blinded by the Light: The Growing Complexity of p53.

  2009cited by this paper
• Cell cycle, CDKs and cancer: a changing paradigm

  2009cited by this paper
• Mesenchymal cells from limbal stroma of human eye

  2008cited by this paper
• TRE-dependent transcription activation by JDP2–CHOP10 association

  2008cited by this paper
• Role of the repressor JDP2 in the amino acid‐regulated transcription of CHOP

  2008cited by this paper
• Insertional mutagenesis reveals progression genes and checkpoints in MYC/Runx2 lymphomas.

  2007cited by this paper
• JDP2 suppresses adipocyte differentiation by regulating histone acetylation

  2007influential reference
• Regulation of histone acetylation and nucleosome assembly by transcription factor JDP2

  2006influential reference
• Tumor model-specific proviral insertional mutagenesis of the Fos/Jdp2/Batf locus.

  2005cited by this paper
• Depletion of the AP-1 repressor JDP2 induces cell death similar to apoptosis.

  2005cited by this paper
• The c-Jun Dimerization Protein 2 Inhibits Cell Transformation and Acts as a Tumor Suppressor Gene*

  2004cited by this paper
• Cyclin A2 Mediates Cardiomyocyte Mitosis in the Postmitotic Myocardium*

  2004cited by this paper
• Jun Dimerization Protein 2 (JDP2), a Member of the AP-1 Family of Transcription Factor, Mediates Osteoclast Differentiation Induced by RANKL

  2003cited by this paper
• Partial oncogenic transformation of chicken embryo fibroblasts by Jun dimerization protein 2, a negative regulator of TRE- and CRE-dependent transcription

  2003cited by this paper
• Induction of Terminal Differentiation by the c-Jun Dimerization Protein JDP2 in C2 Myoblasts and Rhabdomyosarcoma Cells*

  2002cited by this paper
• Identification of oncogenes collaborating with p27Kip1 loss by insertional mutagenesis and high-throughput insertion site analysis

  2002cited by this paper
• JDP2, a Repressor of AP-1, Recruits a Histone Deacetylase 3 Complex To Inhibit the Retinoic Acid-Induced Differentiation of F9 Cells

  2002influential reference
• AP-1 Repressor Protein JDP-2: Inhibition of UV-Mediated Apoptosis through p53 Down-Regulation

  2001cited by this paper
• Identification of mouse Jun dimerization protein 2 as a novel repressor of ATF‐2

  2001cited by this paper
• Human Cyclin a Is Required for Mitosis until Mid Prophase

  1999cited by this paper
• CDK inhibitors: positive and negative regulators of G1-phase progression.

  1999cited by this paper
• Suppression of tumor promoter-induced oxidative stress and inflammatory responses in mouse skin by a superoxide generation inhibitor 1'-acetoxychavicol acetate.

  1998influential reference
• The ras recruitment system, a novel approach to the study of protein-protein interactions.

  1998cited by this paper
• Isolation of an AP-1 repressor by a novel method for detecting protein-protein interactions

  1997influential reference
• A distinct cyclin A is expressed in germ cells in the mouse.

  1996cited by this paper
• Cell cycle control in mammalian cells: role of cyclins, cyclin dependent kinases (CDKs), growth suppressor genes and cyclin-dependent kinase inhibitors (CKIs).

  1995cited by this paper
• Cyclin A is required at two points in the human cell cycle.

  1992cited by this paper

• Fipronil-based insecticide induces developmental toxicity and skeletal deformities in zebrafish (Danio rerio).

  2026cites this paper
• New insights into coordinated regulation of AHR promoter transcription; molecular mechanisms and therapeutic targets

  2025cites this paper
• The AHR-NRF2-JDP2 gene battery: Ligand-induced AHR transcriptional activation.

  2025cites this paper
• Trans-differentiation of Jdp2-depleted Gaba-receptor-positive cerebellar granule cells to Purkinje cells

  2024cites this paper
• A High-Throughput Screen for Antiproliferative Peptides in Mammalian Cells Identifies Key Transcription Factor Families.

  2024cites this paper
• Vulnerability of Antioxidant Drug Therapies on Targeting the Nrf2-Trp53-Jdp2 Axis in Controlling Tumorigenesis

  2024cites this paper
• Hazardous fipronil insecticide effects on aquatic animals' health: Historical review and trends.

  2024cites this paper
• Possible Strategies to Reduce the Tumorigenic Risk of Reprogrammed Normal and Cancer Cells

  2024cites this paper
• Off‐target effects of statins: molecular mechanisms, side effects and the emerging role of kinases

  2024cites this paper
• Jun Dimerization Protein 2 (JDP2) Increases p53 Transactivation by Decreasing MDM2

  2024cites this paper
• Di-n-butyl phthalate promotes the neural differentiation of mouse embryonic stem cells through neurogenic differentiation 1.

  2024cites this paper
• Jdp2 is a spatiotemporal transcriptional activator of the AhR via the Nrf2 gene battery

  2023cites this paper
• Regulation of UHRF1 acetylation by TIP60 is important for colon cancer cell proliferation

  2022cites this paper
• Deletion of Jdp2 enhances Slc7a11 expression in Atoh-1 positive cerebellum granule cell progenitors in vivo

  2021cites this paper
• Prevention of tumor risk associated with the reprogramming of human pluripotent stem cells

  2020cites this paper
• ATF3 and JDP2 deficiency in cancer associated fibroblasts promotes tumor growth via SDF-1 transcription

  2019cites this paper
• Jun Dimerization Protein 2 Activates Mc2r Transcriptional Activity: Role of Phosphorylation and SUMOylation

  2017cites this paper
• G protein‐coupled receptor kinase 4‐induced cellular senescence and its senescence‐associated gene expression profiling

  2017cites this paper
• Reprogramming Antagonizes the Oncogenicity of HOXA13‐Long Noncoding RNA HOTTIP Axis in Gastric Cancer Cells

  2017cites this paper
• Transcription factor TLX1 controls retinoic acid signaling to ensure spleen development.

  2016cites this paper
• The β-catenin/CBP-antagonist ICG-001 inhibits pediatric glioma tumorigenicity in a Wnt-independent manner

  2016cites this paper
• Positive Feedback Loop of OCT4 and c‐JUN Expedites Cancer Stemness in Liver Cancer

  2016cites this paper
• Multiple functions of the histone chaperone Jun dimerization protein 2.

  2016influential citation
• Host JDP2 expression in the bone marrow contributes to metastatic spread

  2015cites this paper
• Cloning and characterization of the mouse JDP2 gene promoter reveal negative regulation by p53.

  2014cites this paper
• Role of Chromatin-Remodeling Factor Jun Dimerization Protein 2 (JDP2) in Cellular Senescence

  2014cites this paper
• CATTCACCGCATGGCTTCAGGACGTCAGGACGCTTTGGTGGACAGTGGGTAGGGATTAAGGCTTCCAAAC GCCTTAAACCCCCGCCCATGCTCCTCCGCGGAAAAACAAAACAAGCTTGCGAGATCCTGCAGCGTCCGAA GACACCACTGCGCGGAACCCTCGCTCTGGATTTGGGGGAGAGCGCACCGGACGGAGGAGGATGGTTCGGC GTGGGCTGAGCTGGAAGGGGTTCTCTGCTCATCCGGCCGCCGCCTTCGCGTCGCTGCCTCCCGGGCTGTG TAGCATTTTGGGGGTG

  2014cites this paper
• Cdk1-Mediated Phosphorylation of Human ATF7 at Thr-51 and Thr-53 Promotes Cell-Cycle Progression into M Phase

  2014cites this paper
• Construction of a lentiviral T/A vector for direct analysis of PCR-amplified promoters

  2014cites this paper
• Ras inhibition boosts galectin-7 at the expense of galectin-1 to sensitize cells to apoptosis

  2013cites this paper
• Androgen receptor-mediated apoptosis in bovine testicular induced pluripotent stem cells in response to phthalate esters

  2013cites this paper
• Inflammatory responses in primary muscle cell cultures in Atlantic salmon (Salmo salar)

  2013cites this paper
• Jun dimerization protein 2 is a critical component of the Nrf2/MafK complex regulating the response to ROS homeostasis

  2013influential citation
• Control of Oxidative Stress and Generation of Induced Pluripotent Stem Cell-like Cells by Jun Dimerization Protein 2

  2013cites this paper
• Preeclamptic plasma induces transcription modifications involving the AP-1 transcriptional regulator JDP2 in endothelial cells.

  2013cites this paper
• Role of cyclins in controlling progression of mammalian spermatogenesis.

  2013cites this paper
• JDP2 inhibits the epithelial-to-mesenchymal transition in pancreatic cancer BxPC3 cells

  2012cites this paper
• Jdp 2 downregulates Trp 53 transcription to promote leukaemogenesis in the context of Trp 53 heterozygosity

  2012cites this paper
• 2 Warm Welcome

  2012cites this paper
• Jdp2 downregulates Trp53 transcription to promote leukaemogenesis in the context of Trp53 heterozygosity

  2012cites this paper
• Mechanistic correlations between two itch biomarkers, cytokine interleukin‐31 and neuropeptide β‐endorphin, via STAT3/calcium axis in atopic dermatitis

  2012cites this paper
• Developmental regulation of CYCA2s contributes to tissue‐specific proliferation in Arabidopsis

  2011cites this paper
• Global Gene Expression Analysis of Murine Limb Development

  2011cites this paper
• Phosphorylation of JDP2 on threonine-148 by the c-Jun N-terminal kinase targets it for proteosomal degradation.

  2011cites this paper
• Jun Dimerization Protein 2 Controls Senescence and Differentiation via Regulating Histone Modification

  2010cites this paper
• Histone Chaperone Jun Dimerization Protein 2 (JDP2): Role in Cellular Senescence and Aging

  2010cites this paper