The Synthetic Gene Designer: a flexible web platform to explore sequence manipulation for heterologous expression.

No abstract is available for this paper.

• Publication year

  2006

• Venue

  Protein Expression and Purification

• Publication date

  2006-06-01

• Fields of study

  Biology, Medicine, Computer Science

• Identifiers
  DOI 10.1016/J.PEP.2005.10.020PMID 16376569
• External record

  Open on Semantic Scholar

• Source metadata

  Semantic Scholar, PubMed

• No claims are published for this paper.

• No concepts are published for this paper.

• UpGene: Application of a Web‐Based DNA Codon Optimization Algorithm

  2008cited by this paper
• JCat: a novel tool to adapt codon usage of a target gene to its potential expression host

  2005cited by this paper
• GeMS: an advanced software package for designing synthetic genes

  2005cited by this paper
• Codon optimization reveals critical factors for high level expression of two rare codon genes in Escherichia coli: RNA stability and secondary structure but not tRNA abundance.

  2004cited by this paper
• Codon bias and heterologous protein expression.

  2004cited by this paper
• Codon optimization and mRNA amplification effectively enhances the immunogenicity of the hepatitis C virus nonstructural 3/4A gene

  2004cited by this paper
• Codon optimizer: a freeware tool for codon optimization.

  2003cited by this paper
• Codon adaptation index as a measure of dominating codon bias

  2003cited by this paper
• Synonymous codon usage bias and the expression of human glucocerebrosidase in the methylotrophic yeast, Pichia pastoris.

  2002cited by this paper
• DNAWorks: an automated method for designing oligonucleotides for PCR-based gene synthesis.

  2002cited by this paper
• Correlation between sequence conservation of the 5' untranslated region and codon usage bias in Mus musculus genes.

  2001cited by this paper
• Rewiring the keyboard: evolvability of the genetic code

  2001cited by this paper
• Relationship of codon bias to mRNA concentration and protein length in Saccharomyces cerevisiae

  2000cited by this paper
• High-level expression and mutagenesis of recombinant human phosphatidylcholine transfer protein using a synthetic gene: evidence for a C-terminal membrane binding domain.

  2000cited by this paper
• Gene synthesis, bacterial expression and purification of the Rickettsia prowazekii ATP/ADP translocase.

  1999cited by this paper
• Codon usage tabulated from the international DNA sequence databases; its status 1999

  1999cited by this paper
• Bacterial expression and purification of biologically active mouse c‐Fos proteins by selective codon optimization

  1997cited by this paper
• Errors of heterologous protein expression.

  1996cited by this paper
• Ribosome‐mediated translational pause and protein domain organization

  1996cited by this paper
• On-line tools for sequence retrieval and multivariate statistics in molecular biology

  1996cited by this paper
• Condon usage tabulated from the international DNA sequence databases

  1996cited by this paper
• Effects of rare codon clusters on high-level expression of heterologous proteins in Escherichia coli.

  1995cited by this paper
• Codon usage in Caenorhabditis elegans: delineation of translational selection and mutational biases

  1994cited by this paper
• HIV1 integrase expressed in Escherichia coli from a synthetic gene.

  1993cited by this paper
• Evaluation of Foreign Gene Codon Optimization in Yeast: Expression of a Mouse IG Kappa Chain

  1991cited by this paper
• "Silent" sites in Drosophila genes are not neutral: evidence of selection among synonymous codons.

  1988cited by this paper
• The codon Adaptation Index--a measure of directional synonymous codon usage bias, and its potential applications.

  1987cited by this paper
• Synonymous codon usage in Bacillus subtilis reflects both translational selection and mutational biases.

  1987cited by this paper
• Codon usage in regulatory genes in Escherichia coli does not reflect selection for 'rare' codons.

  1986cited by this paper
• Codon usage in yeast: cluster analysis clearly differentiates highly and lowly expressed genes

  1986cited by this paper
• Codon usage and gene expression.

  1986cited by this paper
• Effect of distribution of unfavourable codons on the maximum rate of gene expression by an heterologous organism.

  1986cited by this paper

• An Integer Linear Programming Model to Optimize Coding DNA Sequences By Joint Control of Transcript Indicators

  2024cites this paper
• A statistical-physics approach for codon usage optimisation

  2024cites this paper
• An exploratory in silico comparison of open-source codon harmonization tools

  2023cites this paper
• Optimization of Recombinant Glucagon-like Peptide-1 Production Using Recombinant E. coli

  2023cites this paper
• Rule Analysis of Teaching Evaluation System Based on Data Mining under Web Platform

  2022cites this paper
• Tailoring Codon Usage to the Underlying Biology for Protein Expression Optimization.

  2022cites this paper
• mRNA Treatment Rescues Niemann-Pick Disease Type C1 in Patient Fibroblasts

  2022cites this paper
• iCodon customizes gene expression based on the codon composition

  2022cites this paper
• Optimal Design of Synthetic DNA Sequences Without Unwanted Binding Sites

  2022cites this paper
• Evolution and host adaptability of plant RNA viruses: Research insights on compositional biases

  2022cites this paper
• Eliminating unwanted patterns with minimal interference

  2021cites this paper
• iCodon: ideal codon design for customized gene expression

  2021cites this paper
• THE REGENTS OF THE UNIVERSITY OF CALIFORNIA, UNIVERSITY OF VIENNA, AND EMMANUELLE CHARPENTIER

  2020cites this paper
• Codon optimization with deep learning to enhance protein expression

  2020cites this paper
• Optimizing the dynamics of protein expression

  2019cites this paper
• Strategies of codon optimization for high-level heterologous protein expression in microbial expression systems

  2017cites this paper
• Title 1 IntelliEppi : Intelligent reaction monitoring and holistic data management 2 system for the molecular biology lab 3 4 Authors 5

  2017cites this paper
• Recombinant production, purification and characterization of vessel dilator in E. coli.

  2017cites this paper
• IntelliEppi: Intelligent reaction monitoring and holistic data management system for the molecular biology lab

  2017cites this paper
• Synthetic gene design—The rationale for codon optimization and implications for molecular pharming in plants

  2017cites this paper
• Design Automation in Synthetic Biology.

  2017cites this paper
• Soluble expression and purification of the recombinant bioactive peptide precursor BPP-1 in Escherichia coli using a cELP-SUMO dual fusion system.

  2016cites this paper
• Corrigendum: EuGene: maximizing synthetic gene design for heterologous expression

  2016cites this paper
• Critical reflections on synthetic gene design for recombinant protein expression.

  2016cites this paper
• Decoding mechanisms by which silent codon changes influence protein biogenesis and function.

  2015cites this paper
• Design, Construction and Cloning of Truncated ORF2 and tPAsp-PADRE-Truncated ORF2 Gene Cassette From Hepatitis E Virus in the pVAX1 Expression Vector

  2015cites this paper
• Proposed data model for the next version of the synthetic biology open language.

  2015cites this paper
• Structural characterisation of the prokaryotic sodium channel C-terminal domain

  2015cites this paper
• Genome Calligrapher: A Web Tool for Refactoring Bacterial Genome Sequences for de Novo DNA Synthesis.

  2015cites this paper
• Design, Construction and Cloning of Truncated ORF2 and tPA sp -PADRE- Truncated ORF2 Gene Cassette From Hepatitis E Virus in the pVAX1

  2015cites this paper
• ATGme: Open-source web application for rare codon identification and custom DNA sequence optimization

  2015cites this paper
• Expression of codon optimized genes in microbial systems: current industrial applications and perspectives

  2014cites this paper
• Advances and Computational Tools towards Predictable Design in Biological Engineering

  2014cites this paper
• A critical analysis of codon optimization in human therapeutics.

  2014cites this paper
• Codon Optimization OnLine (COOL): a web-based multi-objective optimization platform for synthetic gene design

  2014cites this paper
• COStar: a D-star Lite-based dynamic search algorithm for codon optimization.

  2014cites this paper
• Expression of soluble and active interferon consensus in SUMO fusion expression system in E. coli.

  2014cites this paper
• Enhanced Expression of GCRV VP6 in CIK Cells by Relative Sequence Optimization

  2014cites this paper
• Technology mapping of genetic circuit designs

  2014influential citation
• PROJETO DE UMSEMI-SINTÉTICOGENE CRY1ACE ANÁLISE DA ESTRUTURADA PROTEÍNATRADUZIDA

  2013cites this paper
• EuGene: maximizing synthetic gene design for heterologous expression.

  2012cites this paper
• Tobacco etch virus protease retains its activity in various buffers and in the presence of diverse additives.

  2012cites this paper
• ACCTGTATTTCCAGGGCCACCACCACCACCACCACGGTGAAT CGCGGGCCTTTGAACAGAGATTCACCGTGGTGGT CCCGATCTCTTCTACCATCTGCCACCTTACTAAT TGGTGTGGCCGTCAGATTCATTAGTAAGGTGGCA TGGTATCGGTTTCGGTCCGTTCATCATCACCAA ACGACGAAACAGGTGTTTGTTGGTGATGATGAAC ACCCTGCTGGTACAGAGCCTGCACGGCGTTTTCA GTGGTGGTGTTCTTAACTTTGAAAACGCCGTGCA GCACCTGATTGAC

  2012influential citation
• Codon usage: Nature's roadmap to expression and folding of proteins

  2011cites this paper
• Expression of biologically active human insulin‐like growth factor 1 in Arabidopsis thaliana seeds via oleosin fusion technology

  2011cites this paper
• Cloning, codon-optimized expression and homology modeling of structural protein VP1 from foot and mouth disease virus

  2011cites this paper
• Cloning, soluble expression, and production of recombinant antihypertensive peptide multimer (AHPM-2) in Escherichia coli for bioactivity identification.

  2011cites this paper
• Suitability of different β-galactosidases as reporter enzymes in Bacillus subtilis

  2011cites this paper
• Development of next-generation optical neural silencers

  2011cites this paper
• Synthetic physiology strategies for adapting tools from nature for genetically targeted control of fast biological processes.

  2011cites this paper
• Efficient codon optimization with motif engineering

  2011cites this paper
• Visual gene developer: a fully programmable bioinformatics software for synthetic gene optimization

  2011influential citation
• Codon adaptation–based control of protein expression in C. elegans

  2011cites this paper
• Synthetic gene design with a large number of hidden stops

  2010cites this paper
• Enhanced periplasmic expression of high affinity humanized scFv against Hepatitis B surface antigen by codon optimization.

  2010cites this paper
• QPSOBT: One codon usage optimization software for protein heterologous expression

  2010cites this paper
• Protein Expression in Nonconventional Yeasts

  2010cites this paper
• Expression of mannanases in fermentative yeasts.

  2009cites this paper
• CodonExplorer: an interactive online database for the analysis of codon usage and sequence composition.

  2009cites this paper
• Spirodela (duckweed) as an alternative production system for pharmaceuticals: a case study, aprotinin

  2008cites this paper
• Optimizing the codon usage of synthetic gene with QPSO algorithm.

  2008cites this paper
• Synthetic Gene Design with a Large Number of Hidden Stop Codons

  2008cites this paper
• Functional expression of porcine aminoacylase 1 in E. coli using a codon optimized synthetic gene and molecular chaperones

  2008cites this paper
• High-level expression of soluble viral structural protein in Escherichia coli.

  2008cites this paper
• Optimization of human interferon gamma production in Escherichia coli by response surface methodology

  2008cites this paper
• High-Level Expression and Novel Purification Strategy of Recombinant Thanatin Analog in Escherichia coli

  2008cites this paper
• On the Design of Oligos for Gene Synthesis

  2007cites this paper
• Optimal encoding rules for synthetic genes: the need for a community effort

  2007cites this paper
• NOVEL ALGORITHMS FOR IN VITRO GENE SYNTHESIS

  2007cites this paper
• Analyse de cinétique translationnelle utilisant des afficheurs graphiques de valeurs cinétiques translationnelles de paires de codon

  2007cites this paper
• Procédé de production d'une protéine de fusion

  2007cites this paper
• SGDB: a database of synthetic genes re-designed for optimizing protein over-expression

  2006cites this paper
• Gene Designer: a synthetic biology tool for constructing artificial DNA segments

  2006cites this paper
• Working toward a new NIOSH.

  1996cites this paper
• The Interdisciplinary Center, Herzliya Eliminating unwanted patterns with minimal interferences

  year unknowncites this paper