A cDNA coding for human sex hormone binding globulin Homology to vitamin K‐dependent protein S

No abstract is available for this paper.

• Publication year

  1987

• Venue

  FEBS Letters

• Publication date

  1987-08-10

• Fields of study

  Biology, Medicine

• Identifiers
  DOI 10.1016/0014-5793(87)80890-6PMID 2956126
• External record

  Open on Semantic Scholar

• Source metadata

  Semantic Scholar, PubMed

• No claims are published for this paper.

• No concepts are published for this paper.

• Cloning and characterization of human liver cDNA encoding a protein S precursor.

  1987cited by this paper
• Rat androgen-binding protein: evidence for identical subunits and amino acid sequence homology with human sex hormone-binding globulin.

  1987cited by this paper
• Localization of thrombin cleavage sites in the amino-terminal region of bovine protein S.

  1986cited by this paper
• Steroid-binding site of human and rabbit sex steroid binding protein of plasma: fluorescence characterization with equilenin.

  1986cited by this paper
• Amino acid sequence of the sex steroid binding protein of human blood plasma.

  1986cited by this paper
• Isolation and sequence of the cDNA for human protein S, a regulator of blood coagulation.

  1986cited by this paper
• Physicochemical characteristics of human sex hormone binding globulin: evidence for two identical subunits.

  1986cited by this paper
• Primary structure of bovine vitamin K-dependent protein S.

  1986cited by this paper
• There are two forms of androgen binding protein in human testes. Comparison of their protomeric variants with serum testosterone-estradiol binding globulin.

  1985cited by this paper
• Interaction Between Vitamin K-Dependent Protein S and the Complement Protein, C4b-Binding Protein

  1984cited by this paper
• Electroimmunoassay of sex hormone binding globulin. Enhanced sensitivity by autoradiography using A-ring 125I-17-beta-oestradiol.

  1984cited by this paper
• Yeast RNA polymerase II genes: isolation with antibody probes.

  1983cited by this paper
• Current status of the molecular structure and function of the plasma sex steroid-binding protein (SBP).

  1983cited by this paper
• Study of the carbohydrate moiety of human serum sex hormone-binding globulin.

  1983cited by this paper
• Efficient isolation of genes by using antibody probes.

  1983cited by this paper
• Buffer gradient gels and 35S label as an aid to rapid DNA sequence determination.

  1983cited by this paper
• Demonstration of heavy and light protomers of human testosterone-estradiol-binding globulin.

  1983cited by this paper
• Automation of the computer handling of gel reading data produced by the shotgun method of DNA sequencing.

  1982cited by this paper
• An interactive graphics program for comparing and aligning nucleic acid and amino acid sequences.

  1982cited by this paper
• A simple two-step procedure for the simultaneous isolation of corticosteroid binding globulin and sex hormone binding globulin from human serum by chromatography on cortisol-Sepharose and phenyl-Sepharose.

  1981cited by this paper
• Secretion of testosterone-estradiol-binding globulin by a human hepatoma-derived cell line.

  1981cited by this paper
• Regulation of activated protein C by protein S. The role of phospholipid in factor Va inactivation.

  1981cited by this paper
• DNA sequencing with chain-terminating inhibitors.

  1977cited by this paper
• SEX‐HORMONE‐BINDING GLOBULIN

  1974cited by this paper

• The anticoagulant function of coagulation factor

  2017cites this paper
• Expression von Sex Hormone-Binding Globulin (SHBG) im Kleinhirn der Ratte während der Postnatalentwicklung

  2014cites this paper
• The anticoagulant function of coagulation factor V

  2011cites this paper
• Sex Hormone-Binding Globulin (SHBG), estradiol and breast cancer.

  2010cites this paper
• Characterisation of the molecular mechanism required for glucocorticoid augmentation of macrophage phagocytosis of apoptotic neutrophils

  2010cites this paper
• Activated protein C cofactor function of protein S: a critical role for Asp95 in the EGF1-like domain

  2010cites this paper
• Sex Hormone-binding Globulin (SHBG) and Estradiol Cross-talk in Breast Cancer Cells

  2006cites this paper
• Ligandbindungsstudien des humanen Steroidhormon-bindenden Globulins in einem Biosensorsystem

  2005cites this paper
• The gamma-carboxyglutamic acid domain of anticoagulant protein S is involved in activated protein C cofactor activity, independently of phospholipid binding.

  2005cites this paper
• New biological concepts on coagulation inhibitors

  2005cites this paper
• The gamma-carboxyglutamic acid ( Gla ) domain of anticoagulant protein S is involved in activated protein C-cofactor activity , independently of phospholipid binding Running title : PS Gla domain-mediated APC-cofactor activity

  2004cites this paper
• Functional properties of the sex-hormone-binding globulin (SHBG)-like domain of the anticoagulant protein S.

  2003cites this paper
• Deletion or replacement of the second EGF-like domain of protein S results in loss of APC cofactor activity.

  2003cites this paper
• BEYOND CARRIER PROTEINS Sex hormone-binding globulin is synthesized in target cells

  2002cites this paper
• PSCysS PSCysA PSAlaS PSAlaA PSGluS PSGluA PSLysS PSLvsA CCCTCGTCTAGATGGATGTA AGTGGTGTCGACAACTCCAG CTTGAATAT ETCCATCCAC GTGGATGGACAAATATTCAAG CCTGAATATGCTCCATCCACGG CCGTGGATGGAGCAATATCAAGG ACCTGAATATGAACCATCCACGGGC GCCCGTGGATGG ‘ TTCAATATTCAAGGT ACCTTGAATATTAAACCATCCACGGGC GCCCGTGGATGG

  2002cites this paper
• Implication of protein S thrombin-sensitive region with membrane binding via conformational changes in the gamma-carboxyglutamic acid-rich domain.

  2001cites this paper
• The interaction between anticoagulant protein S and complement regulatory C4b-binding protein (C4BP).

  2000cites this paper
• Scientific and Standardization Committee Communication Protein S Deficiency: A Database of Mutations - FIRST UPDATE For the Plasma Coagulation Inhibitors Subcommittee of the Scientific and Standardization Committee of the International Society on Thrombosis and Haemostasis

  2000cites this paper
• The Second Laminin G-type Domain of Protein S Is Indispensable for Expression of Full Cofactor Activity in Activated Protein C-catalysed Inactivation of Factor Va and Factor VIIIa

  2000cites this paper
• Regulation of Human Sex Hormone-Binding Globulin Gene (

  2000cites this paper
• The sex steroid binding protein (SBP or SHBG) of human plasma: identification of Tyr-57 and Met-107 in the steroid binding site.

  2000cites this paper
• Identification and regulation of receptor tyrosine kinases Rse and Mer and their ligand Gas6 in testicular somatic cells.

  2000cites this paper
• Heterologous expression of wild type and deglycosylated human sex steroid-binding protein (SBP or SHBG) in the yeast, Pichia pastoris. Characterization of the recombinant proteins.

  1999cites this paper
• EGF-like module pair 3-4 in vitamin K-dependent protein S: modulation of calcium affinity of module 4 by module 3, and interaction with factor X.

  1999cites this paper
• Regulation of the protein C anticoagulant pathway by C4b-binding protein

  1999cites this paper
• Both G-type domains of protein S are required for the high-affinity interaction with C4b-binding protein.

  1999cites this paper
• Contributions of Gla and EGF-like domains to the function of vitamin K-dependent coagulation factors.

  1999cites this paper
• Comparative breast tumor imaging and comparative in vitro metabolism of 16alpha-[18F]fluoroestradiol-17beta and 16beta-[18F]fluoromoxestrol in isolated hepatocytes.

  1999cites this paper
• Sex Hormone-Binding Globulin: Not only a transport protein. What news is around the corner?

  1999cites this paper
• Comparative breast tumor imaging and comparative in vitro metabolism of 16α-[18F]Fluoroestradiol-17β and 16β-[18f]fluoromoxestrol in isolated hepatocytes

  1999cites this paper
• Dominant expression of sex‐hormone‐binding‐globulin exon‐7 splicing variant over wild‐type mRNA in human ovarian cancers

  1998cites this paper
• Secretion and Metabolism of Steroids in Primate Mammals During Pregnancy

  1998cites this paper
• Relatively High Expression Ratio of Sex Hormone‐binding Globulin Exon VII Splicing Variant to Wild‐type mRNA in Human Uterine Cervical Cancers

  1998cites this paper
• Characterization of mini-protein S, a recombinant variant of protein S that lacks the sex hormone binding globulin-like domain.

  1998cites this paper
• Photoaffinity labeling of homologous Met-133 and Met-139 amino acids of rabbit and sheep sex hormone-binding globulins with the unsubstituted Delta 6-testosterone photoreagent.

  1998cites this paper
• A Region of Vitamin K-dependent Protein S That Binds to C4b Binding Protein (C4BP) Identified Using Bacteriophage Peptide Display Libraries*

  1997cites this paper
• The High Affinity Calcium-binding Sites in the Epidermal Growth Factor Module Region of Vitamin K-dependent Protein S*

  1997cites this paper
• Secondary structure and shape of plasma sex steroid-binding protein--comparison with domain G of laminin results in a structural model of plasma sex steroid-binding protein.

  1997cites this paper
• Biologically active steroid and thyroid hormones stimulate secretion of sex hormone-binding globulin by human term placenta in culture.

  1997cites this paper
• Binding site for C4b-binding protein in vitamin K-dependent protein S fully contained in carboxy-terminal laminin-G-type repeats. A study using recombinant factor IX-protein S chimeras and surface plasmon resonance.

  1997cites this paper
• Rabbit sex hormone binding globulin: primary structure, tissue expression, and structure/function analyses by expression in Escherichia coli.

  1997cites this paper
• Expression of sex hormone-binding globulin exon VII splicing variant messenger RNA in human uterine endometrial cancers.

  1997cites this paper
• Protein S Deficiency: A Database of Mutations

  1997cites this paper
• Identification of Gas6 as a ligand for Mer, a neural cell adhesion molecule related receptor tyrosine kinase implicated in cellular transformation

  1997cites this paper
• Characterization and developmental expression patterns of testicular androgen-binding protein in the Djungarian hamster (Phodopus sungorus).

  1997cites this paper
• Calcium-binding properties of the third and fourth epidermal-growth-factor-like modules in vitamin-K-dependent protein S.

  1997cites this paper
• SHBG region of the anticoagulant cofactor protein S: Secondary structure prediction, circular dichroism spectroscopy, and analysis of naturally occurring mutations

  1997cites this paper
• Sex hormone binding globulin mRNA in human breast cancer: detection in cell lines and tumor samples.

  1996cites this paper
• Hereditary Thrombophilic Disease Associated with Defects in the Protein C Anticoagulant System.

  1996cites this paper
• Severe perinatal thrombosis in double and triple heterozygous offspring of a family segregating two independent protein S mutations and a protein C mutation.

  1996cites this paper
• Molecular Biological Analysis of Hereditary Protein S Deficiency

  1996cites this paper
• Characterization of Gas6, a Member of the Superfamily of G Domain-containing Proteins, as a Ligand for Rse and Axl (*)

  1996cites this paper
• Molecular basis of a hereditary type I protein S deficiency caused by a substitution of Cys for Arg474.

  1996cites this paper
• Regulation of sex hormone binding globulin and insulin-like growth factor binding protein-1.

  1996cites this paper
• Identification of 19 protein S gene mutations in patients with phenotypic protein S deficiency and thrombosis. Protein S Study Group.

  1996cites this paper
• The protein C anticoagulant system: inherited defects as basis for venous thrombosis.

  1995cites this paper
• The gene encoding vitamin K-dependent anticoagulant protein S is expressed in multiple rabbit organs as demonstrated by northern blotting, in situ hybridization, and immunohistochemistry.

  1995cites this paper
• Detection and characterization of seven novel protein S (PROS) gene lesions: evaluation of reverse transcript-polymerase chain reaction as a mutation screening strategy.

  1995cites this paper
• Potential functions of plasma steroid-binding proteins.

  1995cites this paper
• Developmental expression of protein C and protein S in the rat.

  1995cites this paper
• Molekularbiologische Grundlagen und Diagnostik der hereditären Defekte von Antithrombin III, Protein C und Protein S

  1994cites this paper
• Vitamin K-dependent protein S in Leydig cells of human testis.

  1994cites this paper
• Hemostatic parameters and platelet activation by flow-cytometry in normal pregnancy: a longitudinal study

  1994cites this paper
• Recombinant human protein C, protein S and thrombomodulin as antithrombotics

  1994cites this paper
• Chapter 11. Antithrombotic and Anti-Inflammatory Agents of The Protein C Anticoagulant Pathway

  1994cites this paper
• Structure, function, and regulation of androgen-binding protein/sex hormone-binding globulin.

  1994cites this paper
• Cloning and sequencing of a cDNA encoding the murine vitamin K-dependent protein S.

  1994cites this paper
• TheProtein Encoded byaGrowthArrest-Specific Gene(gas6) IsaNewMemberoftheVitamin K-Dependent Proteins Related toProtein S,aNegative Coregulator intheBlood

  1993cites this paper
• The protein encoded by a growth arrest-specific gene (gas6) is a new member of the vitamin K-dependent proteins related to protein S, a negative coregulator in the blood coagulation cascade

  1993cites this paper
• Calcium Binding Properties of Vitamin K-Dependent Clotting Factors

  1993cites this paper
• Protein S Tokushima: An Abnormal Protein S Found in a Japanese Family with Thrombosis

  1993cites this paper
• Role of Sex Hormone - Binding Globulin in Polycystic Ovary Syndrome

  1993cites this paper
• Characterization of Met-139 as the photolabeled amino acid residue in the steroid binding site of sex hormone binding globulin using delta 6 derivatives of either testosterone or estradiol as unsubstituted photoaffinity labeling reagents.

  1992cites this paper
• Human basement membrane heparan sulfate proteoglycan core protein: a 467-kD protein containing multiple domains resembling elements of the low density lipoprotein receptor, laminin, neural cell adhesion molecules, and epidermal growth factor

  1992cites this paper
• Mammalian expression of the human sex steroid‐binding protein of plasma (SBP or SHBG) and testis (ABP) Characterization of the recombinant protein

  1992cites this paper
• Binding of anticoagulant vitamin K-dependent protein S to platelet-derived microparticles.

  1992cites this paper
• Structural Motifs of the Extracellular Matrix Proteins Laminin and Tenascin

  1992cites this paper
• Solution-phase equilibrium binding interaction of human protein S with C4b-binding protein.

  1991cites this paper
• Protein S and C4b-Binding Protein: Components Involved in the Regulation of the Protein C Anticoagulant System

  1991cites this paper
• The interaction between complement component C4b-binding protein and the vitamin K-dependent protein S forms a link between blood coagulation and the complement system.

  1991cites this paper
• The plasma sex steroid binding protein (SBP or SHBG). A critical review of recent developments on the structure, molecular biology and function.

  1991cites this paper
• Structure-function relationships of epidermal growth factor modules in vitamin K-dependent clotting factors.

  1991cites this paper
• Sex hormone-binding globulin: anatomy and physiology of a new regulatory system.

  1991cites this paper
• The genes for SHBG/ABP and the SHBG-like region of vitamin K-dependent protein S have evolved from a common ancestral gene.

  1991cites this paper
• Plasma steroid-binding proteins.

  1991cites this paper
• Effects of sex hormone binding globulin (SHBG) on human prostatic carcinoma.

  1991cites this paper
• Intron-exon organization of the active human protein S gene PS alpha and its pseudogene PS beta: duplication and silencing during primate evolution.

  1990cites this paper
• Organization of the human protein S genes.

  1990cites this paper
• Molecular analysis of the gene for vitamin K dependent protein S and its pseudogene. Cloning and partial gene organization.

  1990cites this paper
• Identification of lysine 134 in the steroid-binding site of the sex steroid-binding protein of human plasma.

  1990cites this paper
• Histidine 235 of human sex hormone-binding globulin is the covalent site of attachment of the nucleophilic steroid derivative, 17 beta-bromoacetoxydihydrotestosterone.

  1990cites this paper
• Characterization of functionally important domains in human vitamin K-dependent protein S using monoclonal antibodies.

  1990cites this paper
• Delineation and synthesis of the membrane receptor-binding domain of sex hormone-binding globulin.

  1990cites this paper
• Intron-exon organization of the active human protein S gene PS alpha and its pseudogene PS beta: duplication and silencing during primate evolution.

  1990cites this paper
• Gamma-carboxylated isoforms of recombinant human protein S with different biologic properties.

  1990cites this paper
• Effect of testosterone on regulation of the level of sex steroid-binding protein mRNA in monkey (Macaca fascicularis) liver.

  1990cites this paper
• 2-Iodoestradiol binds with high affinity to human sex hormone binding globulin (SHBG).

  1990cites this paper
• Novel type of very high affinity calcium-binding sites in beta-hydroxyasparagine-containing epidermal growth factor-like domains in vitamin K-dependent protein S.

  1990cites this paper
• Molecular properties of corticosteroid binding globulin and the sex-steroid binding proteins.

  1990cites this paper
• The functions of corticosteroid-binding globulin and sex hormone-binding globulin: recent advances.

  1990cites this paper