Snf1 Is a Regulator of Lipid Accumulation in Yarrowia lipolytica

No abstract is available for this paper.

• Publication year

  2013

• Venue

  Applied and Environmental Microbiology

• Publication date

  2013-09-20

• Fields of study

  Biology, Medicine, Environmental Science

• Identifiers
  DOI 10.1128/AEM.02079-13PMID 24056466PMCID PMC3837744
• External record

  Open on Semantic Scholar

• Source metadata

  Semantic Scholar, PubMed

• No claims are published for this paper.

• No concepts are published for this paper.

• Production of omega-3 eicosapentaenoic acid by metabolic engineering of Yarrowia lipolytica

  2013influential reference
• Engineering the push and pull of lipid biosynthesis in oleaginous yeast Yarrowia lipolytica for biofuel production.

  2013cited by this paper
• Transcriptional repression by glycerol of genes involved in the assimilation of n-alkanes and fatty acids in yeast Yarrowia lipolytica.

  2013cited by this paper
• BIOTECHNOLOGICALLY RELEVANT ENZYMES AND PROTEINS Identification and characterization of new Δ-17 fatty acid desaturases

  2013cited by this paper
• AMPK: a nutrient and energy sensor that maintains energy homeostasis

  2012cited by this paper
• Three diacylglycerol acyltransferases contribute to oil biosynthesis and normal growth in Yarrowia lipolytica

  2012cited by this paper
• Metabolism and Regulation of Glycerolipids in the Yeast Saccharomyces cerevisiae

  2012cited by this paper
• Engineering Yarrowia lipolytica to express secretory invertase with strong FBA1IN promoter

  2012cited by this paper
• The AMPK/SNF1/SnRK1 fuel gauge and energy regulator: structure, function and regulation

  2011cited by this paper
• Structure of Mammalian AMPK and its regulation by ADP

  2011cited by this paper
• Citric acid, biomass and cellular lipid production by Yarrowia lipolytica strains cultivated on olive mill wastewater‐based media

  2011cited by this paper
• Lipids of oleaginous yeasts. Part I: Biochemistry of single cell oil production.

  2011cited by this paper
• Transcriptomic Analyses during the Transition from Biomass Production to Lipid Accumulation in the Oleaginous Yeast Yarrowia lipolytica

  2011cited by this paper
• ADP Regulates SNF1, the Saccharomyces cerevisiae Homolog of AMP-Activated Protein Kinase

  2011cited by this paper
• Involvement of the G3P shuttle and β-oxidation pathway in the control of TAG synthesis and lipid accumulation in Yarrowia lipolytica.

  2011cited by this paper
• The ‘LipoYeasts’ project: using the oleaginous yeast Yarrowia lipolytica in combination with specific bacterial genes for the bioconversion of lipids, fats and oils into high‐value products

  2010cited by this paper
• Isolation and characterization of the carbon catabolite‐derepressing protein kinase Snf1 from the stress tolerant yeast Torulaspora delbrueckii

  2010cited by this paper
• The β‐subunits of the Snf1 kinase in Saccharomyces cerevisiae, Gal83 and Sip2, but not Sip1, are redundant in glucose derepression and regulation of sterol biosynthesis

  2010cited by this paper
• Yarrowia lipolytica: A model microorganism used for the production of tailor‐made lipids

  2010cited by this paper
• Transcriptional regulation of nonfermentable carbon utilization in budding yeast.

  2010cited by this paper
• Detection and analysis of alternative splicing in Yarrowia lipolytica reveal structural constraints facilitating nonsense-mediated decay of intron-retaining transcripts

  2010cited by this paper
• Biosynthesis of lipids and organic acids by Yarrowia lipolytica strains cultivated on glucose

  2009influential reference
• Yarrowia lipolytica as a model for bio-oil production.

  2009cited by this paper
• Yas3p, an Opi1 Family Transcription Factor, Regulates Cytochrome P450 Expression in Response to n-Alkanes in Yarrowia lipolytica*

  2009influential reference
• SNF1/AMPK pathways in yeast.

  2008cited by this paper
• Detection of endogenous Snf1 and its activation state: application to Saccharomyces and Candida species

  2008cited by this paper
• Differential control of isocitrate lyase gene transcription by non‐fermentable carbon sources in the milk yeast Kluyveromyces lactis

  2008cited by this paper
• Cloning and characterization of an acyl-CoA-dependent diacylglycerol acyltransferase 1 (DGAT1) gene from Tropaeolum majus, and a study of the functional motifs of the DGAT protein using site-directed mutagenesis to modify enzyme activity and oil content.

  2008cited by this paper
• Regulation of Snf1 Protein Kinase in Response to Environmental Stress*

  2007cited by this paper
• Basic Helix-Loop-Helix Transcription Factor Heterocomplex of Yas1p and Yas2p Regulates Cytochrome P450 Expression in Response to Alkanes in the Yeast Yarrowia lipolytica

  2007cited by this paper
• AMP-activated/SNF1 protein kinases: conserved guardians of cellular energy

  2007cited by this paper
• A mutation in Arabidopsis cytochrome b5 reductase identified by high-throughput screening differentially affects hydroxylation and desaturation.

  2006cited by this paper
• Role of Tos3, a Snf1 Protein Kinase Kinase, during Growth of Saccharomyces cerevisiae on Nonfermentable Carbon Sources

  2005cited by this paper
• Histone H3 phosphorylation can promote TBP recruitment through distinct promoter‐specific mechanisms

  2005cited by this paper
• Combined Global Localization Analysis and Transcriptome Data Identify Genes That Are Directly Coregulated by Adr1 and Cat8

  2005cited by this paper
• Pak1 Protein Kinase Regulates Activation and Nuclear Localization of Snf1-Gal83 Protein Kinase

  2004cited by this paper
• Activation of yeast Snf1 and mammalian AMP-activated protein kinase by upstream kinases

  2003cited by this paper
• Multiple Pathways Are Co-regulated by the Protein Kinase Snf1 and the Transcription Factors Adr1 and Cat8*

  2003cited by this paper
• Regulation of lipid accumulation in oleaginous micro-organisms.

  2002cited by this paper
• Gene Expression Omnibus: NCBI gene expression and hybridization array data repository

  2002cited by this paper
• Inhibition of Acetyl Coenzyme A Carboxylase Activity Restores Expression of the INO1 Gene in a snf1Mutant Strain of Saccharomyces cerevisiae

  2001cited by this paper
• Expression of the SNF1 gene from Candida tropicalis is required for growth on various carbon sources, including glucose

  1999cited by this paper
• AMP-activated kinase reciprocally regulates triacylglycerol synthesis and fatty acid oxidation in liver and muscle: evidence that sn-glycerol-3-phosphate acyltransferase is a novel target.

  1999cited by this paper
• Snf1 Protein Kinase Regulates Phosphorylation of the Mig1 Repressor in Saccharomyces cerevisiae

  1998cited by this paper
• A gene homologous to Saccharomyces cerevisiae SNF1 appears to be essential for the viability of Candida albicans

  1997cited by this paper
• FOG1 and FOG2 genes, required for the transcriptional activation of glucose-repressible genes of Kluyveromyces lactis, are homologous to GAL83 and SNF1 of Saccharomyces cerevisiae

  1996cited by this paper
• Disruption of the SNF1 gene abolishes trehalose utilization in the pathogenic yeast Candida glabrata

  1996cited by this paper
• Bacterial expression of the catalytic domain of 3-hydroxy-3-methylglutaryl-CoA reductase (isoform HMGR1) from Arabidopsis thaliana, and its inactivation by phosphorylation at Ser577 by Brassica oleracea 3-hydroxy-3-methylglutaryl-CoA reductase kinase.

  1995cited by this paper
• Mammalian AMP-activated protein kinase shares structural and functional homology with the catalytic domain of yeast Snf1 protein kinase.

  1994cited by this paper
• Yeast SNF1 is functionally related to mammalian AMP-activated protein kinase and regulates acetyl-CoA carboxylase in vivo.

  1994cited by this paper
• Control of peroxisome proliferation in Saccharomyces cerevisiae by ADR1, SNF1 (CAT1, CCR1) and SNF4 (CAT3)

  1992cited by this paper
• The Saccharomyces cerevisiae ADR1 gene is a positive regulator of transcription of genes encoding peroxisomal proteins

  1991cited by this paper
• Regulation of HMG‐CoA reductase: identification of the site phosphorylated by the AMP‐activated protein kinase in vitro and in intact rat liver.

  1990cited by this paper

• Recent Advancements and Strategies for Omega‐3 Fatty Acid Production in Yeast

  2025influential citation
• Molecular Triggers of Yeast Pathogenicity in the Yeast–Host Interactions

  2025cites this paper
• Enhancing Lipid Production in Yarrowia lipolytica Through Continuous Fermentation and Adaptive Laboratory Evolution in Bioreactors

  2025cites this paper
• The effect of exogenous addition of metformin hydrochloride on lipid synthesis in Mucor circinelloides WJ11

  2025cites this paper
• Nitrogen limitation causes a seismic shift in redox state and phosphorylation of proteins implicated in carbon flux and lipidome remodeling in Rhodotorula toruloides

  2025cites this paper
• Impact of calcium modulation and starvation on fermentation-driven lipid accumulation in the oleaginous fungus Mucor circinelloides

  2025cites this paper
• Engineering yeast for tailored fatty acid profiles

  2025cites this paper
• SNF1 plays a crucial role in the utilization of n-alkane and transcriptional regulation of the genes involved in it in the yeast Yarrowia lipolytica

  2024cites this paper
• Strategies for cultivation, enhancing lipid production, and recovery in oleaginous yeasts.

  2024cites this paper
• Engineering Rhodosporidium toruloides for sustainable production of value-added punicic acid from glucose and wood residues

  2024cites this paper
• Engineering Saccharomyces cerevisiae for the production of punicic acid-rich yeast biomass

  2024cites this paper
• Deletion of LsSNF1 enhances lipid accumulation in the oleaginous yeast Lipomyces starkeyi.

  2024cites this paper
• Biomanufacturing of γ-linolenic acid-enriched galactosyldiacylglycerols: Challenges in microalgae and potential in oleaginous yeasts

  2023cites this paper
• bZIP transcription factor FabR: Redox-dependent mechanism controlling docosahexaenoic acid biosynthesis and H2O2 stress response in Schizochytrium sp.

  2023cites this paper
• Role of AMP Deaminase in Mucor circinelloides: Implications for Nitrogen Utilization and Lipid Biosynthesis.

  2023cites this paper
• Effect of carbon and nitrogen concentrations on lipid accumulation and regulation of acetyl-CoA carboxylase in Papiliotrema laurentii

  2023cites this paper
• Reprogramming the fatty acid metabolism of Yarrowia lipolytica to produce the customized omega-6 polyunsaturated fatty acids.

  2023cites this paper
• Lipid Accumulation by Snf-β Engineered Mucor circinelloides Strains on Glucose and Xylose

  2023influential citation
• Effect of Different Carbons on Lipid Production and SNF1 Transcription in Mucor Circinelloides

  2023cites this paper
• Lipid accumulation and SNF1 transcriptional analysis of Mucor circinelloides on xylose under nitrogen limitation

  2023cites this paper
• LsSpt23p is a regulator of triacylglycerol synthesis in the oleaginous yeast Lipomyces starkeyi

  2023cites this paper
• Knocking out central metabolism genes to identify new targets and alternating substrates to improve lipid synthesis in Y. lipolytica

  2023cites this paper
• Identification and characterization of fatty acid desaturases in Schizochytrium sp. HX-308

  2022cites this paper
• Growth conditions inducing G1 cell cycle arrest enhance lipid production in the oleaginous yeast Lipomyces starkeyi.

  2022cites this paper
• Exploring Yeast Diversity to Produce Lipid-Based Biofuels from Agro-Forestry and Industrial Organic Residues

  2022cites this paper
• Engineering Yarrowia lipolytica to produce nutritional fatty acids: Current status and future perspectives

  2022cites this paper
• The relationship between amino acid and lipid metabolism in oleaginous eukaryotic microorganism

  2022cites this paper
• Evaluation of Different Standard Amino Acids to Enhance the Biomass, Lipid, Fatty Acid, and γ-Linolenic Acid Production in Rhizomucor pusillus and Mucor circinelloides

  2022cites this paper
• Zinc Finger Protein LipR Represses Docosahexaenoic Acid and Lipid Biosynthesis in Schizochytrium sp.

  2022cites this paper
• GATA-type transcriptional factor SpGAT1 interacts with SpMIG1 and promotes lipid accumulation in the oleaginous yeast Saitozyma podzolica zwy-2-3 Biotechnology for Biofuels and Bioproducts

  2022cites this paper
• GATA-type transcriptional factor SpGAT1 interacts with SpMIG1 and promotes lipid accumulation in the oleaginous yeast $$Saitozyma \ podzolica$$ S a i

  2022cites this paper
• Recent advances in biotechnological production of polyunsaturated fatty acids by Yarrowia lipolytica

  2021cites this paper
• Elevated β-Carotene Production Using Codon-Adapted CarRA&B and Metabolic Balance in Engineered Yarrowia lipolytica

  2021cites this paper
• Recent advances in lipid metabolic engineering of oleaginous yeasts.

  2021cites this paper
• Role of Snf-β in lipid accumulation in the high lipid‐producing fungus Mucor circinelloides WJ11

  2021cites this paper
• Disruption of the Snf1 Gene Enhances Cell Growth and Reduces the Metabolic Burden in Cellulase-Expressing and Lipid-Accumulating Yarrowia lipolytica

  2021cites this paper
• Strategies for increasing lipid accumulation and recovery from Y. lipolytica: A review

  2021influential citation
• SNF1β-Modulated Glucose Uptake and the Balance between Polyunsaturated Fatty Acids and Carbohydrates in Mortierella alpina.

  2021cites this paper
• Progress of metabolic engineering for the production of eicosapentaenoic acid

  2021cites this paper
• Improving the Production of Punicic Acid in Baker's Yeast by Engineering Genes in Acyl Channeling Processes and Adjusting Precursor Supply.

  2021cites this paper
• Yarrowia lipolytica as an Oleaginous Platform for the Production of Value-Added Fatty Acid-Based Bioproducts

  2021cites this paper
• Lipid production by oleaginous yeasts.

  2021cites this paper
• Exploring Proteomes of Robust Yarrowia lipolytica Isolates Cultivated in Biomass Hydrolysate Reveals Key Processes Impacting Mixed Sugar Utilization, Lipid Accumulation, and Degradation

  2021cites this paper
• Genetic and bioprocess engineering to improve squalene production in Yarrowia lipolytica

  2020cites this paper
• Genome-Wide Characterization and Analysis of CIPK Gene Family in Two Cultivated Allopolyploid Cotton Species: Sequence Variation, Association with Seed Oil Content, and the Role of GhCIPK6

  2020cites this paper
• Enhanced erythritol production by a Snf1-deficient Yarrowia lipolytica strain under nitrogen-enriched fermentation condition

  2020cites this paper
• Discovery and identification of medium‐chain fatty acid responsive promoters in Saccharomyces cerevisiae

  2020cites this paper
• Optimizing mevalonate pathway for squalene production in Yarrowia lipolytica

  2020cites this paper
• Metabolic engineering for increased lipid accumulation in Yarrowia lipolytica - A Review.

  2020cites this paper
• High production of triterpenoids in Yarrowia lipolytica through manipulation of lipid components

  2020cites this paper
• Annotation of AMP-activated protein kinase genes and its comparative transcriptional analysis between high and low lipid producing strains of Mucor circinelloides

  2020cites this paper
• Engineering the oleaginous yeast Yarrowia lipolytica for high-level resveratrol production

  2020cites this paper
• Metabolic Engineering of Oleaginous Yeast Yarrowia lipolytica for Overproduction of Fatty Acids

  2020cites this paper
• Improved lipogenesis in Mortierella alpina by abolishing the Snf4-mediated energy-saving mode under low glucose.

  2020cites this paper
• Systems‐level approaches for understanding and engineering of the oleaginous cell factory Yarrowia lipolytica

  2020influential citation
• Combinatorial engineering Yarrowia lipolytica as a promising cell biorefinery platform for the production of multi-purpose long chain dicarboxylic acid building blocks from glycerol

  2020cites this paper
• Annotation of AMP-activated protein kinase genes and its comparative transcriptional analysis between high and low lipid producing strains of Mucor circinelloides

  2020cites this paper
• Engineering acetyl-CoA metabolic shortcut for eco-friendly production of polyketides triacetic acid lactone in Yarrowia lipolytica

  2019cites this paper
• Characterization of three Yarrowia lipolytica strains in respect to different cultivation temperatures and metabolite secretion

  2019cites this paper
• Biologie intégrative du métabolisme lipidique chez les levures du genre Blastobotrys

  2019cites this paper
• Effects of a high cultivation temperature on the physiology of three different Yarrowia lipolytica strains.

  2019cites this paper
• Microbial Oils as Nutraceuticals and Animal Feeds

  2018cites this paper
• Functional genomics for the oleaginous yeast Yarrowia lipolytica.

  2018cites this paper
• Lipid accumulation from glucose and xylose in an engineered, naturally oleaginous strain of Saccharomyces cerevisiae

  2018influential citation
• Genome-scale model-driven strain design for dicarboxylic acid production in Yarrowia lipolytica

  2018cites this paper
• Comparative transcriptome analysis reveals multiple functions for Mhy1p in lipid biosynthesis in the oleaginous yeast Yarrowia lipolytica.

  2018influential citation
• CIPK9 is involved in seed oil regulation in Brassica napus L. and Arabidopsis thaliana (L.) Heynh.

  2018cites this paper
• Recent Advances in Metabolic Engineering of Yarrowia lipolytica for Lipid Overproduction

  2018cites this paper
• Critical steps in carbon metabolism affecting lipid accumulation and their regulation in oleaginous microorganisms

  2018cites this paper
• Microbial conversion of xylose into useful bioproducts

  2018cites this paper
• Holistic Approaches in Lipid Production by Yarrowia lipolytica.

  2018cites this paper
• Lipid biosynthesis in yeasts: A comparison of the lipid biosynthetic pathway between the model nonoleaginous yeast Saccharomyces cerevisiae and the model oleaginous yeast Yarrowia lipolytica

  2017cites this paper
• Functional genomics of lipid metabolism in the oleaginous yeast Rhodosporidium toruloides

  2017cites this paper
• YaliBricks, a versatile genetic toolkit for streamlined and rapid pathway engineering in Yarrowia lipolytica

  2017cites this paper
• Combining metabolic evolution and systematic fed-batch optimization for efficient single-cell oil production from sugarcane bagasse

  2017cites this paper
• Leucine Biosynthesis Is Involved in Regulating High Lipid Accumulation in Yarrowia lipolytica

  2017cites this paper
• Expanding the Genetic Toolbox to Improve Metabolic Engineering in the Industrial Oleaginous Yeast, Yarrowia lipolytica

  2017cites this paper
• The stress-regulatory transcription factors Msn2 and Msn4 regulate fatty acid oxidation in budding yeast

  2017cites this paper
• Metabolic Engineering of Oleaginous Yeasts for Production of Fuels and Chemicals

  2017cites this paper
• Engineering Yarrowia lipolytica for Enhanced Production of Lipid and Citric Acid

  2017influential citation
• Integrating Cellular and Bioprocess Engineering in the Non-Conventional Yeast Yarrowia lipolytica for Biodiesel Production: A Review

  2017cites this paper
• Combinatorial Engineering of Yarrowia lipolytica as a Promising Cell Biorefinery Platform for the de novo Production of Multi-Purpose Long Chain Dicarboxylic Acids

  2017cites this paper
• Regulation of amino-acid metabolism controls flux to lipid accumulation in Yarrowia lipolytica

  2016cites this paper
• Metabolic Engineering Strategies to Convert Carbohydrates to Aviation Range Hydrocarbons

  2016cites this paper
• Microbial oils as food additives: recent approaches for improving microbial oil production and its polyunsaturated fatty acid content.

  2016cites this paper
• Industrial systems biology and its impact on synthetic biology of yeast cell factories.

  2016cites this paper
• Functional overexpression and characterization of lipogenesis-related genes in the oleaginous yeast Yarrowia lipolytica

  2016cites this paper
• Recent advances in bioengineering of the oleaginous yeast Yarrowia lipolytica

  2016cites this paper
• Comparison of Nitrogen Depletion and Repletion on Lipid Production in Yeast and Fungal Species

  2016cites this paper
• Metabolic engineering of Yarrowia lipolytica for industrial applications.

  2015cites this paper
• Utilising Yeast as a Model Organism to Deconstruct the Regulation of Tumour Associated Lipogenesis

  2015cites this paper
• Surveying the lipogenesis landscape in Yarrowia lipolytica through understanding the function of a Mga2p regulatory protein mutant.

  2015influential citation
• A repressor activator protein1 homologue from an oleaginous strain of Candida tropicalis increases storage lipid production in Saccharomyces cerevisiae.

  2015cites this paper
• Biotechnological applications of Yarrowia lipolytica: Past, present and future.

  2015cites this paper
• Metabolic engineering of Saccharomyces cerevisiae to improve 1-hexadecanol production.

  2015cites this paper
• Development and physiological characterization of cellobiose‐consuming Yarrowia lipolytica

  2015cites this paper
• Protein kinase Snf1 is involved in the proper regulation of the unfolded protein response in Saccharomyces cerevisiae.

  2015cites this paper
• Fatty Aldehyde Dehydrogenase Multigene Family Involved in the Assimilation of n-Alkanes in Yarrowia lipolytica*

  2014cites this paper
• CTATGACCATGATTACGCCAAGCTGCAAATTAAAGCCTTCGAGC 3 AAGGCGCGCCGTGAGCAAGCAGATCCTGAA 4 AAGGCGCGCCCTATTACACCCACTCGTGCA 5 AAACATATGGTCAGCTTTGGAGCTCGAATCAAGGACTT 6 TGCCAGGTCTCGGTCCTAGGGAAAGCCTTGGAGAAGCCGTCATGGATCTTGCACT 7 TCTCCAAGGCTTTCCCTAGGACCGAGACCTGGCACAACATCGGAGACCTGCTGGA 8 AAATTCGAATTAGTTGGAGAGCTCGAGACC

  2014cites this paper
• BbSNF1 contributes to cell differentiation, extracellular acidification, and virulence in Beauveria bassiana, a filamentous entomopathogenic fungus

  2014cites this paper