Substrate‐specific binding of hook‐associated proteins by FlgN and FliT, putative chaperones for flagellum assembly

No abstract is available for this paper.

• Publication year

  1999

• Venue

  Molecular Microbiology

• Publication date

  1999-05-01

• Fields of study

  Biology, Medicine, Chemistry

• Identifiers
  DOI 10.1046/j.1365-2958.1999.01372.xPMID 10320579
• External record

  Open on Semantic Scholar

• Source metadata

  Semantic Scholar, PubMed

• No claims are published for this paper.

• No concepts are published for this paper.

• Secretion of YscP from Yersinia enterocolitica is essential to control the length of the injectisome needle but not to change the type III secretion substrate specificity

  2005cited by this paper
• Molecular Cloning: A Laboratory Manual

  2001cited by this paper
• Sequence Analysis

  2000cited by this paper
• Type III Protein Secretion Systems in Bacterial Pathogens of Animals and Plants

  1998cited by this paper
• Plugging interactions of HAP2 pentamer into the distal end of flagellar filament revealed by electron microscopy.

  1998cited by this paper
• Protein folding in the cytosol: chaperonin-dependent and -independent mechanisms.

  1998cited by this paper
• The chaperone/usher pathway: a major terminal branch of the general secretory pathway.

  1998cited by this paper
• Targeting of Yersinia Yop proteins into the cytosol of HeLa cells: one‐step translocation of YopE across bacterial and eukaryotic membranes is dependent on SycE chaperone

  1998cited by this paper
• EspB and EspD require a specific chaperone for proper secretion from enteropathogenic Escherichia coli

  1998cited by this paper
• The Sec system.

  1998cited by this paper
• A motile but non‐swarming mutant of Proteus mirabilis lacks FlgN, a facilitator of flagella filament assembly

  1997influential reference
• Negative feedback from a Proteus class II flagellum export defect to the flhDC master operon controlling cell division and flagellum assembly

  1997cited by this paper
• Molecular architecture of bacterial flagellum

  1997cited by this paper
• Two independent type III secretion mechanisms for YopE in Yersinia enterocolitica

  1997cited by this paper
• Self-assembly of the filament capping protein, FliD, of bacterial flagella into an annular structure.

  1996cited by this paper
• Flagella and motility

  1996cited by this paper
• Delivering the payload. Bacterial pathogenesis.

  1996cited by this paper
• Customized secretion chaperones in pathogenic bacteria

  1996influential reference
• Flagellar assembly in Salmonella typhimurium

  1996cited by this paper
• The cytosolic SycE and SycH chaperones of Yersinia protect the region of YopE and YopH involved in translocation across eukaryotic cell membranes

  1996influential reference
• Identification of the YopE and YopH domains required for secretion and internalization into the cytosol of macrophages, using the cyaA gene fusion approach.

  1995cited by this paper
• A segment of the C-terminal half of the G-protein beta 1 subunit specifies its interaction with the gamma 1 subunit.

  1995cited by this paper
• Functional analysis of the flagellar genes in the fliD operon of Salmonella typhimurium.

  1995cited by this paper
• Requirement for FlhA in flagella assembly and swarm‐cell differentiation by Proteus mirabilis

  1995influential reference
• Structural organization and assembly of flagellar hook protein from Salmonella typhimurium.

  1995cited by this paper
• Structural Organization and Assembly of Flagellar Hook Protein fromSalmonella typhimurium

  1995cited by this paper
• Sequence analysis of the flgA gene and its adjacent region in Salmonella typhimurium, and identification of another flagellar gene, flgN

  1994cited by this paper
• Role of the FliA-FlgM regulatory system on the transcriptional control of the flagellar regulon and flagellar formation in Salmonella typhimurium

  1994cited by this paper
• Sequence analysis of the flgA gene and its adjacent region in Salmonella typhimurium, and identification of another flagellar gene, flgN.

  1994cited by this paper
• Individual chaperones required for Yop secretion by Yersinia.

  1994influential reference
• FlgD is a scaffolding protein needed for flagellar hook assembly in Salmonella typhimurium

  1994cited by this paper
• The FlhD/FlhC complex, a transcriptional activator of the Escherichia coli flagellar class II operons

  1994influential reference
• Sensing structural intermediates in bacterial flagellar assembly by export of a negative regulator.

  1993cited by this paper
• Size of the export channel in the flagellar filament of Salmonella typhimurium.

  1993cited by this paper
• SycE, a chaperone‐like protein of Yersinia enterocolitica involved in the secretion of YopE

  1993cited by this paper
• Flagellar growth in a filament-less Salmonella fliD mutant supplemented with purified hook-associated protein 2.

  1993cited by this paper
• Morphological pathway of flagellar assembly in Salmonella typhimurium.

  1992cited by this paper
• Genetics and biogenesis of bacterial flagella.

  1992cited by this paper
• Subdivision of flagellar region III of the Escherichia coli and Salmonella typhimurium chromosomes and identification of two additional flagellar genes.

  1992cited by this paper
• Terminal disorder: a common structural feature of the axial proteins of bacterial flagellum?

  1992cited by this paper
• A novel transcriptional regulation mechanism in the flagellar regulon of Salmonella typhimurium: an anti‐sigma factor inhibits the activity of the flagellum‐specific Sigma factor, σF

  1992cited by this paper
• Closely linked genetic loci required for swarm cell differentiation and multicellular migration by Proteus mirabilis

  1991influential reference
• Predicting coiled coils from protein sequences

  1991influential reference
• Role of the disordered terminal regions of flagellin in filament formation and stability.

  1991cited by this paper
• Energetically distinct early and late stages of HlyB/HlyD‐dependent secretion across both Escherichia coli membranes.

  1991cited by this paper
• Flagellar hook and hook-associated proteins of Salmonella typhimurium and their relationship to other axial components of the flagellum.

  1990influential reference
• Transcriptional analysis of the flagellar regulon of Salmonella typhimurium

  1990cited by this paper
• The binding cascade of SecB to SecA to SecY/E mediates preprotein targeting to the E. coli plasma membrane.

  1990cited by this paper
• Use of T7 RNA polymerase to direct expression of cloned genes.

  1990influential reference
• Terminal regions of flagellin are disordered in solution.

  1989cited by this paper
• Flagellin parts acquiring a regular structure during polymerization are disposed on the molecule ends

  1988cited by this paper
• Flagellar transcriptional activators FlbB and FlaI: gene sequences and 5' consensus sequences of operons under FlbB and FlaI control

  1988cited by this paper
• Localization and stoichiometry of hook-associated proteins within Salmonella typhimurium flagella

  1987cited by this paper
• Use of bacteriophage T7 RNA polymerase to direct selective high-level expression of cloned genes.

  1986influential reference
• Structural genes for flagellar hook-associated proteins in Salmonella typhimurium

  1985cited by this paper
• "Cap" on the tip of Salmonella flagella.

  1985cited by this paper
• Excretion of unassembled hook-associated proteins by Salmonella typhimurium

  1985influential reference
• Genetic Analysis of H 2 , the Structural Gene for Phase-2 Flagellin in Salmonella

  1984cited by this paper
• Excretion of unassembled flagellin by Salmonella typhimurium mutants deficient in hook-associated proteins

  1984cited by this paper
• Hook-associated proteins essential for flagellar filament formation in Salmonella typhimurium

  1984cited by this paper
• Reconstruction in vitro of the flagellar polyhook from Salmonella.

  1982cited by this paper
• Genetic analysis of H2, the structural gene for phase-2 flagellin in Salmonella.

  1975cited by this paper
• Cleavage of Structural Proteins during the Assembly of the Head of Bacteriophage T4

  1970cited by this paper
• Bacterial Flagella: Polarity of Elongation

  1970cited by this paper
• Polarity of flagellar growth in salmonella.

  1969cited by this paper
• RECONSTITUTION OF BACTERIAL FLAGELLA IN VITRO.

  1964cited by this paper
• Behaviour of Active Bacterial Antigens During the Induction of the Immune Response: (I) Properties of Flagellar Antigens from Salmonella

  1963cited by this paper
• The SEC-system

  year unknowncited by this paper

• DNA methylation affects gene expression but not global chromatin structure in Escherichia coli

  2025cites this paper
• The structure of the complete extracellular bacterial flagellum reveals the mechanism of flagellin incorporation

  2025cites this paper
• The RNA degradation enzyme RNase E is essential for early flagellar assembly in Escherichia coli

  2025cites this paper
• The Flagellin‐Specific Chaperone FliS of Borrelia burgdorferi Controls the Cytoplasmic Pool of Flagellins at the Level of Translation Initiation, Secretion, and Proteolysis

  2025cites this paper
• Novel function of single-target regulator NorR involved in swarming motility and biofilm formation revealed in Vibrio alginolyticus

  2024cites this paper
• Evolution of paralogous multicomponent systems for site-specific O-sialylation of flagellin in Gram-negative and Gram-positive bacteria.

  2024cites this paper
• Identification of a new export signal that targets early subunits to the flagellar type III secretion export machinery

  2024cites this paper
• Cyclic-di-AMP confers an invasive phenotype on Escherichia coli through elongation of flagellin filaments

  2024cites this paper
• Helicobacter pylori FlgN binds its substrate FlgK and the flagellum ATPase FliI in a similar manner observed for the FliT chaperone

  2023cites this paper
• Structure, Assembly, and Function of Flagella Responsible for Bacterial Locomotion

  2023cites this paper
• Extracellular transfer of a conserved polymerization factor for multi-flagellin filament assembly in Caulobacter.

  2023cites this paper
• Insight Into Distinct Functional Roles of the Flagellar ATPase Complex for Flagellar Assembly in Salmonella

  2022cites this paper
• Regulator of RNase E activity modulates the pathogenicity of Salmonella Typhimurium.

  2022cites this paper
• Identification of Genes Required for Swarming Motility in Bacillus subtilis Using Transposon Mutagenesis and High-Throughput Sequencing (TnSeq)

  2022influential citation
• The FlgN chaperone activates the Na+-driven engine of the Salmonella flagellar protein export apparatus

  2021cites this paper
• The Polar Flagellar Transcriptional Regulatory Network in Vibrio campbellii Deviates from Canonical Vibrio Species

  2021cites this paper
• The FlgN chaperone activates the Na+-driven engine of the Salmonella flagellar protein export apparatus

  2021cites this paper
• Injectisome T3SS subunits as potential chaperones in the extracellular export of Pectobacterium carotovorum subsp. carotovorum bacteriocins Carocin S1 and Carocin S3 secreted via flagellar T3SS

  2021cites this paper
• Multiple Roles of Flagellar Export Chaperones for Efficient and Robust Flagellar Filament Formation in Salmonella

  2021cites this paper
• Recognition of discrete export signals in early flagellar subunits during bacterial type III secretion

  2020cites this paper
• In Vitro Autonomous Construction of the Flagellar Axial Structure in Inverted Membrane Vesicles

  2020cites this paper
• Chaperone mediated coupling of subunit availability to activation of flagellar Type III Secretion

  2020cites this paper
• [Flagellar related genes and functions in Vibrio].

  2020cites this paper
• The FlgN chaperone activates the Na+-driven engine of the flagellar protein export apparatus

  2020cites this paper
• Engineering the flagellar type III secretion system: improving capacity for secretion of recombinant protein

  2019cites this paper
• Export Mechanisms and Energy Transduction in Type-III Secretion Machines.

  2019cites this paper
• Crystal structure of FlgL and its implications for flagellar assembly

  2018cites this paper
• Role of hypothetical protein YicS in the pathogenicity of Avian Pathogenic Escherichia coli in vivo and in vitro.

  2018cites this paper
• Crystal structure of Bacillus cereus FlgL

  2018cites this paper
• A tetratricopeptide repeat domain protein has profound effects on assembly of periplasmic flagella, morphology and motility of the lyme disease spirochete Borrelia burgdorferi

  2018cites this paper
• Dynamics and Control of Flagella Assembly in Salmonella typhimurium

  2018influential citation
• In Vitro Reconstitution of Functional Type III Protein Export and Insights into Flagellar Assembly

  2018cites this paper
• Crystal structure of the flagellar chaperone FliS from Bacillus cereus and an invariant proline critical for FliS dimerization and flagellin recognition.

  2017cites this paper
• RpoN2- and FliA-regulated fliTX is indispensible for flagellar motility and virulence in Xanthomonas oryzae pv. oryzae

  2017cites this paper
• Importance of Campylobacter jejuni FliS and FliW in Flagella Biogenesis and Flagellin Secretion

  2017influential citation
• Regulation of flagellar mediated motility in the species Samonella enterica

  2017cites this paper
• The role of the FliD C-terminal domain in pentamer formation and interaction with FliT

  2017cites this paper
• Rearrangements of α‐helical structures of FlgN chaperone control the binding affinity for its cognate substrates during flagellar type III export

  2016influential citation
• Structural plasticity of the Salmonella FliS flagellar export chaperone

  2016cites this paper
• Recognition and targeting mechanisms by chaperones in flagellum assembly and operation

  2016cites this paper
• Potential Emergence of Multi-quorum Sensing Inhibitor Resistant (MQSIR) Bacteria

  2016cites this paper
• Chapter 7 – Flagella

  2015cites this paper
• Flagellin Is Required for Host Cell Invasion and Normal Salmonella Pathogenicity Island 1 Expression by Salmonella enterica Serovar Paratyphi A

  2015cites this paper
• More than a locomotive organelle: flagella in Escherichia coli

  2015cites this paper
• Characterization of Helicobacter pylori HP0231 (DsbK): role in disulfide bond formation, redox homeostasis and production of Helicobacter cystein‐rich protein HcpE

  2015cites this paper
• Regulatory principles governing Salmonella and Yersinia virulence

  2015cites this paper
• Flagellar region 3b supports strong expression of integrated DNA and the highest chromosomal integration efficiency of the Escherichia coli flagellar regions

  2015cites this paper
• Genetic regulation of the Type III Secretion System and its potential effect on the lateral flagella system in Aeromonas hydrophila AH-3

  2015cites this paper
• FlgN plays important roles in the adhesion of Aeromonas hydrophila to host mucus.

  2015cites this paper
• [Structure and function of the bacterial flagellar type III protein export system in Salmonella
].

  2015cites this paper
• FliT Selectively Enhances Proteolysis of FlhC Subunit in FlhD4C2 Complex by an ATP-dependent Protease, ClpXP*

  2014cites this paper
• Protein export through the bacterial flagellar type III export pathway.

  2014cites this paper
• Probing the assembly of the Bacillus subtilis flagellum and its role in signal transduction

  2014cites this paper
• Escherichia coli Flagellar Genes as Target Sites for Integration and Expression of Genetic Circuits

  2014cites this paper
• A Novel C-Terminal Region within the

  2014cites this paper
• Analysis of Factors That Affect FlgM-Dependent Type III Secretion for Protein Purification with Salmonella enterica Serovar Typhimurium

  2014cites this paper
• Flagellar biosynthesis exerts temporal regulation of secretion of specific Campylobacter jejuni colonization and virulence determinants

  2014influential citation
• HcpE, a potential immuno-modulatory protein from Helicobacter pylori that is dependent on the Disulfide bond protein DsbHP

  2014cites this paper
• FlgN Is Required for Flagellum-Based Motility by Bacillus subtilis

  2014cites this paper
• Building a flagellum outside the bacterial cell

  2014cites this paper
• Defects in the Flagellar Motor Increase Synthesis of Poly-γ-Glutamate in Bacillus subtilis

  2013cites this paper
• RflM Functions as a Transcriptional Repressor in the Autogenous Control of the Salmonella Flagellar Master Operon flhDC

  2013cites this paper
• Interactions of bacterial flagellar chaperone–substrate complexes with FlhA contribute to co‐ordinating assembly of the flagellar filament

  2013cites this paper
• The role of protein :protein interactions in regulating flagellar assembly

  2013influential citation
• Interaction between FliI ATPase and a flagellar chaperone FliT during bacterial flagellar protein export

  2012cites this paper
• Complete Genome of Ignavibacterium album, a Metabolically Versatile, Flagellated, Facultative Anaerobe from the Phylum Chlorobi

  2012cites this paper
• Expanded Roles for Multicargo and Class 1B Effector Chaperones in Type III Secretion

  2012cites this paper
• Coupling flagellar gene expression to flagellar assembly in Caulobacter crescentus

  2012cites this paper
• YdiV: a dual function protein that targets FlhDC for ClpXP‐dependent degradation by promoting release of DNA‐bound FlhDC complex

  2012cites this paper
• The Flagellar Regulator fliT Represses Salmonella Pathogenicity Island 1 through flhDC and fliZ

  2012cites this paper
• Protein Export According to Schedule: Architecture, Assembly, and Regulation of Type III Secretion Systems from Plant- and Animal-Pathogenic Bacteria

  2012cites this paper
• A Novel C-Terminal Region within the Multicargo Type III Secretion Chaperone CesT Contributes to Effector Secretion

  2012cites this paper
• Swarming motility and the control of master regulators of flagellar biosynthesis

  2012cites this paper
• Interaction of a bacterial flagellar chaperone FlgN with FlhA is required for efficient export of its cognate substrates

  2012influential citation
• Protein traffic in Gram-negative bacteria--how exported and secreted proteins find their way.

  2012cites this paper
• Crystallization and preliminary X-ray analysis of FlgA, a periplasmic protein essential for flagellar P-ring assembly.

  2012cites this paper
• TTGCATCAATACTGGACTC TTGAATTTTCAGATCCCTC AAGCTTTAATACCCGAGCTTCAAG AAGÇTTTCAAGTCAGCGTAATGCT TATCAGAGGTAGTTGGCGTC TGTCTAGCTTCAAGTATGACG CATATGGAAACCAAAATTAATTCAC CTGCAGTTATTTACTTTTTTGTAATTG GGATCCTAATACCCGAGCTTCAAG CATATGACCTCCCTCATTTAAAATTGC ACCCAATATCCTAAAACTTC TGGCAGCTGTATAAATTCCT ACATCTGGCAAAGCACAA

  2012cites this paper
• Proteus mirabilis interkingdom swarming signals attract blow flies

  2012cites this paper
• Type III Secretion Chaperones: A Molecular Toolkit for All Occasions

  2011cites this paper
• Structure of the Flagellar Type III Export Chaperone FliT, and Its Regulatory Mechanism of Flagellar Assembly

  2011cites this paper
• Escherichia coli genome-wide promoter analysis: Identification of additional AtoC binding target elements

  2011cites this paper
• Escherichia coli Genome-Wide Promoter Analysis: Search for Potential AtoC Binding Target Elements

  2011cites this paper
• A Single-Domain FlgJ Contributes to Flagellar Hook and Filament Formation in the Lyme Disease Spirochete Borrelia burgdorferi

  2011cites this paper
• Recombinant protein secretion via the type III secretion system

  2011cites this paper
• Bacterial secretion chaperones.

  2011cites this paper
• The interaction dynamics of a negative feedback loop regulates flagellar number in Salmonella enterica serovar Typhimurium

  2010cites this paper
• Structural insight into the regulatory mechanisms of interactions of the flagellar type III chaperone FliT with its binding partners

  2010cites this paper
• FlhA provides the adaptor for coordinated delivery of late flagella building blocks to the type III secretion system

  2010cites this paper
• The HP0256 gene product is involved in motility and cell envelope architecture of Helicobacter pylori

  2010cites this paper
• Molecular interaction of flagellar export chaperone FliS and cochaperone HP1076 in Helicobacter pylori

  2010cites this paper
• Multiple Promoters Contribute to Swarming and the Coordination of Transcription with Flagellar Assembly in Salmonella

  2010cites this paper
• Purification, crystallization and preliminary X-ray analysis of FliT, a bacterial flagellar substrate-specific export chaperone.

  2009cites this paper
• NMR structure of protein YvyC from Bacillus subtilis reveals unexpected structural similarity between two PFAM families

  2009cites this paper
• Bringing order to a complex molecular machine: the assembly of the bacterial flagella.

  2008cites this paper
• Flagellar motility in bacteria structure and function of flagellar motor.

  2008cites this paper
• Mechanisms of type III protein export for bacterial flagellar assembly.

  2008cites this paper
• FliZ Is a Posttranslational Activator of FlhD4C2-Dependent Flagellar Gene Expression

  2008cites this paper
• The rate of protein secretion dictates the temporal dynamics of flagellar gene expression

  2008influential citation
• Analysis of functional domains present in the N-terminus of the SipB protein.

  2007cites this paper
• EscC is a chaperone for the Edwardsiella tarda type III secretion system putative translocon components EseB and EseD.

  2007cites this paper