Characterization of a glucose-repressed pyruvate kinase (Pyk2p) in Saccharomyces cerevisiae that is catalytically insensitive to fructose-1,6-bisphosphate

No abstract is available for this paper.

• Publication year

  1997

• Venue

  Journal of Bacteriology

• Publication date

  1997-05-01

• Fields of study

  Biology, Medicine, Chemistry

• Identifiers
  DOI 10.1128/jb.179.9.2987-2993.1997PMID 9139918PMCID PMC179064
• External record

  Open on Semantic Scholar

• Source metadata

  Semantic Scholar, PubMed

• No claims are published for this paper.

• No concepts are published for this paper.

• [Pyruvate kinase].

  2020cited by this paper
• Induction of pyruvate decarboxylase in glycolysis mutants of Saccharomyces cerevisiae correlates with the concentrations of three-carbon glycolytic metabolites

  2004cited by this paper
• Genetic and biochemical evidence for hexokinase PII as a key enzyme involved in carbon catabolite repression in yeast

  2004cited by this paper
• Yeast sugar metabolism: biochemistry, genetics, biotechnology, and applications

  1997cited by this paper
• Biothermokinetics of the living cell

  1996cited by this paper
• The allosteric regulation of pyruvate kinase

  1996cited by this paper
• A Yeast Phosphofructokinase Insensitive to the Allosteric Activator Fructose 2,6-Bisphosphate

  1996cited by this paper
• The regulatory characteristics of yeast fructose-1,6-bisphosphatase confer only a small selective advantage

  1996cited by this paper
• Multiple signalling pathways trigger the exquisite sensitivity of yeast gluconeogenic mRNAs to glucose

  1996cited by this paper
• Molecular genetics of ICL2, encoding a non‐functional isocitrate lyase in saccharomyces cerevisiae

  1996cited by this paper
• Cloning of a second gene encoding 6‐phosphofructo‐2‐kinase in yeast, and characterization of mutant strains without fructose‐2,6‐bisphosphate

  1996cited by this paper
• Strategy for deletion of complete open reading frames in Saccharomyces cerevisiae

  1995cited by this paper
• REG1 binds to protein phosphatase type 1 and regulates glucose repression in Saccharomyces cerevisiae.

  1995cited by this paper
• CAT8, a new zinc cluster-encoding gene necessary for derepression of gluconeogenic enzymes in the yeast Saccharomyces cerevisiae

  1995cited by this paper
• Microcompartmentation, metabolic channelling and carbohydrate metabolism.

  1995cited by this paper
• Construction of a set of convenient saccharomyces cerevisiae strains that are isogenic to S288C

  1995cited by this paper
• Glucose repression in fungi.

  1995cited by this paper
• Regulation of pyruvate carboxylase isozyme (PYC1, PYC2) gene expression in Saccharomyces cerevisiae during fermentative and nonfermentative growth.

  1994cited by this paper
• Open reading frames in the antisense strands of genes coding for glycolytic enzymes in Saccharomyces cerevisiae

  1994cited by this paper
• The role of the NAD-dependent glutamate dehydrogenase in restoring growth on glucose of a Saccharomyces cerevisiae phosphoglucose isomerase mutant.

  1993cited by this paper
• Different signals control the activation of glycolysis in the yeast Saccharomyces cerevisiae

  1993influential reference
• Guide to yeast genetics and molecular biology

  1993cited by this paper
• Regulation of sugar utilization by Saccharomyces cerevisiae.

  1992cited by this paper
• Carbon catabolite repression in yeast.

  1992cited by this paper
• Regulation of sugar utilization by Saccharomyces cerevisiae.

  1992cited by this paper
• DNA sequences in chromosomes 11 and VII code for pyruvate carboxylase isoenzymes in Saccharomyces cerevisiae: analysis of pyruvate carboxylase-deficient strains

  1991cited by this paper
• An efficient transformation procedure enabling long‐term storage of competent cells of various yeast genera

  1991cited by this paper
• Glucose repression in Saccharomyces cerevisiae is directly associated with hexose phosphorylation by hexokinases PI and PII.

  1991cited by this paper
• Guide to yeast genetics and molecular biology.

  1991cited by this paper
• Getting started with yeast.

  1991cited by this paper
• The YDp plasmids: A uniform set of vectors bearing versatile gene disruption cassettes for Saccharomyces cerevisiae

  1991influential reference
• Isoenzymes of pyruvate kinase.

  1990cited by this paper
• The residual enzymatic phosphorylation activity of hexokinase II mutants is correlated with glucose repression in Saccharomyces cerevisiae.

  1989cited by this paper
• Isolation and characterization of the gene encoding phosphoenolpyruvate carboxykinase from Saccharomyces cerevisiae

  1989cited by this paper
• The yeast pyruvate kinase gene does not contain a string of non‐ preferred codons: Revised nucleotide sequence

  1989cited by this paper
• New yeast-Escherichia coli shuttle vectors constructed with in vitro mutagenized yeast genes lacking six-base pair restriction sites.

  1988cited by this paper
• Biological Macromolecules and Assemblies

  1987cited by this paper
• Complexes of sequential metabolic enzymes.

  1987cited by this paper
• Active sites of enzymes

  1987cited by this paper
• The structure of cat muscle pyruvate kinase.

  1986cited by this paper
• The M1- and M2-type isozymes of rat pyruvate kinase are produced from the same gene by alternative RNA splicing.

  1986cited by this paper
• Yeast shuttle and integrative vectors with multiple cloning sites suitable for construction of lacZ fusions.

  1986influential reference
• The isolation, characterization, and sequence of the pyruvate kinase gene of Saccharomyces cerevisiae.

  1983cited by this paper
• Codon selection in yeast.

  1982cited by this paper
• The Molecular biology of the yeast Saccharomyces : metabolism and gene expression

  1982cited by this paper
• Cloning of yeast glycolysis genes by complementation.

  1982cited by this paper
• Physiological Effects of Seven Different Blocks in Glycolysis in Saccharomyces cerevisiae

  1979cited by this paper
• Glycolysis mutants in Saccharomyces cerevisiae.

  1978cited by this paper
• Yeast pyruvate kinase: a mutant from catalytically insensitive to fructose 1,6-bisphosphate.

  1977cited by this paper
• A revised preparation of yeast (Saccharomyces cerevisiae) pyruvate kinase.

  1976cited by this paper
• Methoden der enzymatischen Analyse, 3. Auflage. Herausgeb. v. H. U. Bergmeyer, LXXXI, 2353 Seiten in 2 Bänden. Preis DM 460,–, Verlag Chemie, Weinheim/Bergstr., 1974

  1974cited by this paper
• Experiments in molecular genetics

  1972cited by this paper
• Application of kinetics of yeast pyruvate kinase in vitro to calculation of glycolytic flux in the anaerobic yeast cell.

  1972cited by this paper
• Regulation of pyruvate kinase by fructose 1,6-diphosphate in Saccharomyces cerevisiae.

  1971cited by this paper
• A kinetic study of glycolytic enzyme synthesis in yeast.

  1971cited by this paper
• Interaction between Potassium-, Ammonium- and Fructose-1,6-diphosphate Activation of Yeast Pyruvate Kinase

  1967cited by this paper
• Methoden der enzymatischen Analyse

  1962cited by this paper
• [103] Preparation and assay of deoxyribonucleic acid from animal tissue

  1957cited by this paper

• Synergistic regulatory mechanisms in glycolysis revealed by pathway transplantation

  2025influential citation
• Reprogramming Carbon Flux to Eliminate Crabtree Effect-Associated Ethanol Production for High-Yield l-Lactic Acid Biosynthesis in Saccharomyces cerevisiae.

  2025cites this paper
• Kinetic-model-guided engineering of multiple S. cerevisiae strains improves p-coumaric acid production

  2025cites this paper
• ΔΔG Method for Elucidating Key Control Reactions from Relative Quantification Metabolome Data: Comparative Analysis of Yeast Glycolysis.

  2025cites this paper
• Restricted glycolysis is a primary cause of the reduced growth rate of zinc-deficient yeast cells

  2024cites this paper
• Saccharomyces cerevisiae cis-acting DNA sequences curation pipeline (Sc-cADSs-CP): Master transcription factors prediction in yeasts

  2022cites this paper
• Cancer metabolism control by natural products: Pyruvate kinase M2 targeting therapeutics

  2022cites this paper
• Full humanization of the glycolytic pathway in Saccharomyces cerevisiae.

  2022cites this paper
• GwAAP: A genome-wide amino acid coding-decoding quantitative proteomics system

  2022cites this paper
• Increasing glycolysis by deletion of kcs1 and arg82 improved S-adenosyl-l-methionine production in Saccharomyces cerevisiae

  2021cites this paper
• A yeast with muscle doesn’t run faster: full humanization of the glycolytic pathway in Saccharomyces cerevisiae

  2021cites this paper
• Population-level heterogeneity as a reflection of mixed strategy: A computational perspective on the Crabtree effect.

  2021cites this paper
• Novel auto-selection systems for transformation selection of Saccharomyces cerevisiae in rich complex media.

  2021cites this paper
• Reversible amyloids of pyruvate kinase couple cell metabolism and stress granule disassembly

  2021cites this paper
• Analysis of the molecular basis of Saccharomyces cerevisiae mutant with high nucleic acid content by comparative transcriptomics.

  2021cites this paper
• Impact of the Whole Genome Duplication Event on PYK Activity and Effects of a PYK1 Mutation on Metabolism in S. cerevisiae

  2021cites this paper
• Differential localization patterns of pyruvate kinase isoforms in murine naïve, formative and primed pluripotent states

  2020cites this paper
• Differential localization patterns of pyruvate kinase isoforms in murine naïve , 1 formative and primed pluripotent states 2 3

  2020cites this paper
• Biochemical and biophysical characterization of the smallest pyruvate kinase from Entamoeba histolytica.

  2020cites this paper
• Gene expression regulates metabolite homeostasis during the Crabtree effect: Implications for the adaptation and evolution of Metabolism

  2020influential citation
• Pyruvate kinase variant of fission yeast tunes carbon metabolism, cell regulation, growth and stress resistance

  2020cites this paper
• The interaction between metabolism and the plasma membrane potential, and intracellular pH

  2019cites this paper
• Making ATP fast and slow: do yeasts play a mixed strategy to metabolize glucose?

  2019cites this paper
• Molecular evolutionary engineering of xylose isomerase to improve its catalytic activity and performance of micro-aerobic glucose/xylose co-fermentation in Saccharomyces cerevisiae

  2019cites this paper
• A natural variant of the sole pyruvate kinase of fission yeast lowers glycolytic flux triggering increased respiration and oxidative-stress resistance but decreased growth

  2019cites this paper
• An expanded enzyme toolbox for production of cis, cis-muconic acid and other shikimate pathway derivatives in Saccharomyces cerevisiae

  2018cites this paper
• Histone H3 threonine 11 phosphorylation by Sch9 and CK2 regulates chronological lifespan by controlling the nutritional stress response

  2018cites this paper
• Reprogramming Yeast Metabolism from Alcoholic Fermentation to Lipogenesis.

  2018cites this paper
• Synthesis of jojoba-like wax esters in metabolically engineered strains of Saccharomyces cerevisiae

  2018cites this paper
• Ring-shaped corona proteins influence the toxicity of engineered nanoparticles to yeast

  2018cites this paper
• Histone H3 T11 phosphorylation by Sch9 and CK2 regulates lifespan by controlling the nutritional stress response

  2018cites this paper
• Minor Isozymes Tailor Yeast Metabolism to Carbon Availability

  2018cites this paper
• Regulation of Cellular Metabolism through Phase Separation of Enzymes

  2018cites this paper
• l-Arabinose triggers its own uptake via induction of the arabinose-specific Gal2p transporter in an industrial Saccharomyces cerevisiae strain

  2018cites this paper
• Regulation of SESAME-mediated H3T11 phosphorylation by glycolytic enzymes and metabolites

  2017cites this paper
• Increased rates of protein evolution and asymmetric deceleration after the whole-genome duplication in yeasts

  2017influential citation
• The Glycogen Shunt Maintains Glycolytic Homeostasis and the Warburg Effect in Cancer.

  2017cites this paper
• TCTACCATAGCCAATCAAAG CCAGACTTAGAGCTGATGAC GCTTACAGCACCTAAAGATG GGCTCAAATTTAGCACCATC TTGACATGTTCGAGGTGTTC GATCCCTGCTTTACTTGAC 9 AACTAAGGCAGTATCCAAAG GGTTTAGCAGAATCTTTAGC TGCCTACCTTAAATTCTCAC GCAGCTGATCTATCACTTTG TGGAATAACGGAGTGAATAC GTCATGTTCTTCACCATACC 10 AAATGGCCGAAACCATTGGG CTTGTGTTGTTGCTGAATAC AT

  2017cites this paper
• Glycolytic Functions Are Conserved in the Genome of the Wine Yeast Hanseniaspora uvarum, and Pyruvate Kinase Limits Its Capacity for Alcoholic Fermentation

  2017cites this paper
• Effect of the cancer specific shorter form of human 6-phosphofructo-1-kinase on the metabolism of the yeast Saccharomyces cerevisiae

  2017cites this paper
• Carbohydrate Metabolism in Wine Yeasts

  2017cites this paper
• Reversible protein aggregation is a protective mechanism to ensure cell cycle restart after stress

  2017cites this paper
• Screening the yeast genome for energetic metabolism pathways involved in a phenotypic response to the anti-cancer agent 3-bromopyruvate

  2016cites this paper
• Redox-dependent Regulation of Gluconeogenesis by a Novel Mechanism Mediated by a Peroxidatic Cysteine of Peroxiredoxin

  2016cites this paper
• Redirection of pyruvate flux toward desired metabolic pathways through substrate channeling between pyruvate kinase and pyruvate-converting enzymes in Saccharomyces cerevisiae

  2016cites this paper
• Engineering yeast shikimate pathway towards production of aromatics: rational design of a chassis cell using systems and synthetic biology

  2016cites this paper
• Systems-level investigation of the interaction between glucose metabolism and the Snf1/Mig1 signalling pathway

  2016cites this paper
• Flux Control in Glycolysis Varies Across the Tree of Life

  2016cites this paper
• A novel pyruvate kinase and its application in lactic acid production under oxygen deprivation in Corynebacterium glutamicum

  2016cites this paper
• Post-translational modifications on yeast carbon metabolism: Regulatory mechanisms beyond transcriptional control.

  2015cites this paper
• Transcriptional analysis of Kluyveromyces marxianus for ethanol production from inulin using consolidated bioprocessing technology

  2015cites this paper
• Multi‐tasking of biosynthetic and energetic functions of glycolysis explained by supply and demand logic

  2015cites this paper
• Homeostasis and the glycogen shunt explains aerobic ethanol production in yeast

  2015cites this paper
• Patterns of Gene Conversion in Duplicated Yeast Histones Suggest Strong Selection on a Coadapted Macromolecular Complex

  2015cites this paper
• A Minimal Set of Glycolytic Genes Reveals Strong Redundancies in Saccharomyces cerevisiae Central Metabolism

  2015cites this paper
• Serine and SAM Responsive Complex SESAME Regulates Histone Modification Crosstalk by Sensing Cellular Metabolism.

  2015cites this paper
• Reducing the genetic complexity of glycolysis in Saccharomyces cerevisiae

  2015cites this paper
• The origins of mutational robustness.

  2015cites this paper
• Quorum-sensing linked RNA interference for dynamic metabolic pathway control in Saccharomyces cerevisiae.

  2015cites this paper
• Tailoring strain construction strategies for muconic acid production in S. cerevisiae and E. coli

  2014cites this paper
• Dosage, duplication, and diploidization: clarifying the interplay of multiple models for duplicate gene evolution over time.

  2014cites this paper
• Similarities and Differences Between Cancer and Yeast Carbohydrate Metabolism

  2014cites this paper
• Metabolic engineering of

  2014cites this paper
• PKM2 regulates chromosome segregation and mitosis progression of tumor cells.

  2014cites this paper
• Global gene expression analysis of Saccharomyces cerevisiae grown under redox potential-controlled very-high-gravity conditions.

  2013cites this paper
• TOWARD A COMPREHENSIVE UNDERSTANDING OF MICROBIAL METABOLISM

  2013cites this paper
• Proteomic analysis of Saccharomyces cerevisiae grown on glucose or glycerol

  2013cites this paper
• Warburg effect and translocation-induced genomic instability: two yeast models for cancer cells

  2013cites this paper
• Yeast and cancer cells – common principles in lipid metabolism

  2013cites this paper
• Development of a D-xylose fermenting and inhibitor tolerant industrial Saccharomyces cerevisiae strain with high performance in lignocellulose hydrolysates using metabolic and evolutionary engineering

  2013cites this paper
• The metabolism beyond programmed cell death in yeast

  2012cites this paper
• Pathway Based Microarray Analysis, Utilising Enzyme Compounds and Cascade Events

  2012cites this paper
• The effect of selenium enrichment on baker's yeast proteome.

  2012cites this paper
• Regulation of yeast pyruvate kinase by ultrasensitive allostery independent of phosphorylation.

  2012cites this paper
• Yeast as a Window into Changes in Genome Complexity Due to Polyploidization

  2012cites this paper
• Original Article: Isolation, purification and characterization of pyruvate kinase from Staphylococcus aureus : a potential drug target

  2012cites this paper
• Pyruvate kinase is a dosage-dependent regulator of cellular amino acid homeostasis

  2012cites this paper
• UNIVERSIDADE FEDERAL DE PERNAMBUCO CENTRO DE CIÊNCIAS BIOLÓGICAS DEPARTAMENTO DE GENÉTICA PROGRAMA DE PÓS-GRADUACÃO EM GENÉTICA

  2012cites this paper
• Rocking cell metabolism: revised functions of the key glycolytic regulator PKM2 in cancer.

  2012cites this paper
• Quercetin Protects Saccharomyces cerevisiae against Oxidative Stress by Inducing Trehalose Biosynthesis and the Cell Wall Integrity Pathway

  2012cites this paper
• Comparative proteome analysis of Saccharomyces cerevisiae: A global overview of in vivo targets of the yeast activator protein 1

  2012cites this paper
• Functioning of a metabolic flux sensor in Escherichia coli

  2012cites this paper
• Pyruvate Kinase Triggers a Metabolic Feedback Loop that Controls Redox Metabolism in Respiring Cells

  2011cites this paper
• Metabolic engineering of Saccharomyces cerevisiae for C4-dicarboxylic acid production

  2011cites this paper
• Pathway based microarray analysis based on multi-membership gene regulation

  2011cites this paper
• Absolute Quantification of the Glycolytic Pathway in Yeast:

  2011cites this paper
• The Warburg and Crabtree effects: On the origin of cancer cell energy metabolism and of yeast glucose repression.

  2011cites this paper
• Human pyruvate kinase M2: A multifunctional protein

  2010influential citation
• Phosphoenolpyruvate Carboxykinase as the Sole Anaplerotic Enzyme in Saccharomyces cerevisiae

  2010cites this paper
• Metabolome, transcriptome and metabolic flux analysis of arabinose fermentation by engineered Saccharomyces cerevisiae.

  2010cites this paper
• Tumor cell energy metabolism and its common features with yeast metabolism.

  2009cites this paper
• Analysis of Saccharomyces cerevisiae deletion mutants displaying a modified carbon flux under wine fermentative conditions

  2009cites this paper
• Differential Behavior of Missense Mutations in the Intersubunit Contact Domain of the Human Pyruvate Kinase M2 Isozyme*

  2009cites this paper
• In silico evidence for functional specialization after genome duplication in yeast

  2008influential citation
• UNIVERSIT E de CAEN BASSE-NORMANDIE

  2008cites this paper
• Adaptation du métabolisme respiratoire de l'huître creuse Crassostrea gigas

  2008cites this paper
• Trehalose, glycogen and ethanol metabolism in thegcrl mutant ofSaccharomyces cerevisiae

  2008cites this paper
• Mistranslation-induced protein misfolding as a dominant constraint on coding-sequence evolution.

  2008cites this paper
• Transcriptional regulation of pyruvate kinase and phosphoenolpyruvate carboxykinase in the adductor muscle of the oyster Crassostrea gigas during prolonged hypoxia.

  2007cites this paper
• Étude des voies métaboliques des sucres chez l'huître creuse Crassostrea gigas : implication dans les mortalités estivales

  2007cites this paper