Analysis of manganese-regulated gene expression in the ligninolytic basidiomycete Ceriporiopsis subvermispora

No abstract is available for this paper.

• Publication year

  2008

• Venue

  Current Genetics

• Publication date

  2008-08-23

• Fields of study

  Biology, Medicine, Environmental Science

• Identifiers
  DOI 10.1007/s00294-008-0209-7PMID 18726100
• External record

  Open on Semantic Scholar

• Source metadata

  Semantic Scholar, PubMed

• No claims are published for this paper.

• No concepts are published for this paper.

• Assessment of 30 White Rot Basidiomycetes for Selective Lignin Degradation

  2009cited by this paper
• Manganese: recent advances in understanding its transport and neurotoxicity.

  2007cited by this paper
• Functional specialization within the Fur family of metalloregulators

  2007cited by this paper
• Transcriptional profiling by cDNA-AFLP reveals novel insights during methyl jasmonate, wounding and insect attack in Brassica napus

  2007cited by this paper
• A novel gene, screened by cDNA-AFLP approach, contributes to lowering the acidity of fruit in apple.

  2007cited by this paper
• Physiological and biochemical responses to high Mn concentrations in two contrasting Populus cathayana populations.

  2007cited by this paper
• GOGOT: a method for the identification of differentially expressed fragments from cDNA-AFLP data

  2007cited by this paper
• Identification of a Copper-Inducible Promoter for Use in Ectopic Expression in the Fungal Pathogen Histoplasma capsulatum

  2006cited by this paper
• Proteome survey reveals modularity of the yeast cell machinery

  2006cited by this paper
• Computational Reconstruction of Iron- and Manganese-Responsive Transcriptional Networks in α-Proteobacteria

  2006cited by this paper
• CDD: a conserved domain database for interactive domain family analysis

  2006cited by this paper
• Iron-sulfur protein biogenesis in eukaryotes: components and mechanisms.

  2006cited by this paper
• Manganese Transport and Trafficking: Lessons Learned from Saccharomyces cerevisiae

  2005influential reference
• Characterization of the yeast ionome: a genome-wide analysis of nutrient mineral and trace element homeostasis in Saccharomyces cerevisiae

  2005cited by this paper
• Systematic discovery of regulatory motifs in human promoters and 3′ UTRs by comparison of several mammals

  2005cited by this paper
• Managing the manganese: molecular mechanisms of manganese transport and homeostasis.

  2005cited by this paper
• Caenorhabditis elegans PMR1, a P‐type calcium ATPase, is important for calcium/manganese homeostasis and oxidative stress response

  2005cited by this paper
• Metal ion homeostasis in Bacillus subtilis.

  2005cited by this paper
• The Arabidopsis phenylalanine ammonia lyase gene family: kinetic characterization of the four PAL isoforms.

  2004cited by this paper
• Peroxisomes, lipid metabolism, and peroxisomal disorders.

  2004cited by this paper
• Novel Promoter Sequence Required for Manganese Regulation of Manganese Peroxidase Isozyme 1 Gene Expression in Phanerochaete chrysosporium

  2004cited by this paper
• Iron-responsive genes of Phanerochaete chrysosporium isolated by differential display reverse transcription polymerase chain reaction.

  2003cited by this paper
• The KDEL Receptor Modulates the Endoplasmic Reticulum Stress Response through Mitogen-activated Protein Kinase Signaling Cascades*

  2003cited by this paper
• N-terminal acetyltransferases and sequence requirements for N-terminal acetylation of eukaryotic proteins.

  2003cited by this paper
• Differential regulation of genes encoding manganese peroxidase (MnP) in the basidiomycete Ceriporiopsis subvermispora

  2003cited by this paper
• Saccharomyces cerevisiae MPT5 and SSD1 function in parallel pathways to promote cell wall integrity.

  2002cited by this paper
• Large scale identification of genes involved in cell surface biosynthesis and architecture in Saccharomyces cerevisiae

  2002cited by this paper
• Differential cytotoxicity of Mn(II) and Mn(III): special reference to mitochondrial [Fe-S] containing enzymes.

  2001cited by this paper
• Isoenzyme Multiplicity and Characterization of Recombinant Manganese Peroxidases from Ceriporiopsis subvermispora and Phanerochaete chrysosporium

  2001cited by this paper
• A new mathematical model for relative quantification in real-time RT-PCR.

  2001cited by this paper
• Translational regulation by ABC systems.

  2001cited by this paper
• Manganese Superoxide Dismutase in Saccharomyces cerevisiae Acquires Its Metal Co-factor through a Pathway Involving the Nramp Metal Transporter, Smf2p*

  2001cited by this paper
• Resistance to the plant PR-5 protein osmotin in the model fungus Saccharomyces cerevisiae is mediated by the regulatory effects of SSD1 on cell wall composition.

  2001cited by this paper
• Regulation of Yeast H+-ATPase by Protein Kinases Belonging to a Family Dedicated to Activation of Plasma Membrane Transporters

  2000cited by this paper
• Zinc-regulated genes in Saccharomyces cerevisiae revealed by transposon tagging.

  2000cited by this paper
• Saccharomyces cerevisiae Expresses Three Functionally Distinct Homologues of the Nramp Family of Metal Transporters

  2000cited by this paper
• Enzymes and proteins containing manganese: an overview.

  2000cited by this paper
• Manganese metabolism in animals and humans including the toxicity of manganese.

  2000cited by this paper
• Characterization of three new manganese peroxidase genes from the ligninolytic basidiomycete Ceriporiopsis subvermispora.

  2000cited by this paper
• Primer3 on the WWW for general users and for biologist programmers.

  2000cited by this paper
• Iron and manganese homeostasis in chronic liver disease: relationship to pallidal T1-weighted magnetic resonance signal hyperintensity.

  1999cited by this paper
• Sugar- and Nitrogen-Dependent Regulation of an Amanita muscaria Phenylalanine Ammonium Lyase Gene

  1999cited by this paper
• Post-translation Control of Nramp Metal Transport in Yeast

  1999cited by this paper
• Cloning and molecular analysis of a cDNA and the Cs-mnp1 gene encoding a manganese peroxidase isoenzyme from the lignin-degrading basidiomycete Ceriporiopsis subvermispora.

  1998cited by this paper
• The medial-Golgi ion pump Pmr1 supplies the yeast secretory pathway with Ca2+ and Mn2+ required for glycosylation, sorting, and endoplasmic reticulum-associated protein degradation.

  1998influential reference
• Manganese Peroxidase-Dependent Oxidation of Glyoxylic and Oxalic Acids Synthesized by Ceriporiopsis subvermispora Produces Extracellular Hydrogen Peroxide

  1998cited by this paper
• Ssd1p of Saccharomyces cerevisiae Associates with RNA*

  1997cited by this paper
• Large scale identification of genes involved in cell surface biosynthesis and architecture in Saccharomyces cerevisiae.

  1997cited by this paper
• Metabolism of sulfur amino acids in Saccharomyces cerevisiae

  1997cited by this paper
• The Saccharomyces cerevisiae SSD1 gene is involved in the tolerance to high concentration of Ca2+ with the participation of HST1/NRC1/BFR1.

  1996cited by this paper
• A yeast manganese transporter related to the macrophage protein involved in conferring resistance to mycobacteria.

  1996cited by this paper
• Visualization of differential gene expression using a novel method of RNA fingerprinting based on AFLP: analysis of gene expression during potato tuber development.

  1996cited by this paper
• Oxidation reactions catalyzed by manganese peroxidase isoenzymes from Ceriporiopsis subvermispora

  1995cited by this paper
• Isoenzymes of manganese-dependent peroxidase and laccase produced by the lignin-degrading basidiomycete Ceriporiopsis subvermispora.

  1994cited by this paper
• Ultrastructural and Immunocytochemical Studies on the H2O2-Producing Enzyme Pyranose Oxidase in Phanerochaete chrysosporium Grown under Liquid Culture Conditions

  1992cited by this paper
• Evaluating Isolates of Phanerochaete chrysosporium and Ceriporiopsis subvermispora for Use in Biological Pulping Processes

  1992cited by this paper
• Metal-regulated transcription in eukaryotes.

  1992cited by this paper
• Ligninolytic enzymes of the white rot basidiomycetes Phlebia brevispora and Ceriporiopsis subvermispora

  1992cited by this paper
• Manganese peroxidase gene transcription in Phanerochaete chrysosporium: activation by manganese

  1991cited by this paper
• ERD2, a yeast gene required for the receptor-mediated retrieval of luminal ER proteins from the secretory pathway.

  1990cited by this paper
• Identification and characterization of genes and mutants for an N‐terminal acetyltransferase from yeast.

  1989cited by this paper
• The mechanism of N-terminal acetylation of proteins.

  1985cited by this paper
• THE USE OF LEAD CITRATE AT HIGH pH AS AN ELECTRON-OPAQUE STAIN IN ELECTRON MICROSCOPY

  1963cited by this paper
• Journal of Experimental Botany Advance Access published December 14, 2006 Journal of Experimental Botany, Page 1 of 13

  year unknowncited by this paper

• Metabolic Specialization and Codon Preference of Lignocellulolytic Genes in the White Rot Basidiomycete Ceriporiopsis subvermispora

  2020cites this paper
• Transcriptome analysis reveals novel insights into the response to Pb exposure in Phanerochaete chrysosporium.

  2018cites this paper
• Physiological, biochemical and molecular responses of Mentha aquatica L. to manganese.

  2017cites this paper
• Effects of manganese, 2,5-xylidine, veratryl alcohol and tween 80 on the production of ligninolytic enzymes by Ceriporiopsis subvermispora

  2015cites this paper
• Inactivation of a Pleurotus ostreatus versatile peroxidase-encoding gene (mnp2) results in reduced lignin degradation.

  2014cites this paper
• Gene Primers 5 '-3 ' Product ( bp ) Limonene synthase Forward : GATGATATTTACGATGTCTATGGTAC 490 Reverse : GAATTGATTTCGGCACATCGCCTC-Tubulin synthase Forward : CAGCCAGATCTTCACGAGCTT 119 Reverse

  2012cites this paper
• Release of Pleurotus ostreatus Versatile-Peroxidase from Mn2+ Repression Enhances Anthropogenic and Natural Substrate Degradation

  2012cites this paper
• Limonene synthase gene expression under different concentrations of manganese in Cuminum cyminum L.

  2012cites this paper
• Pleurotus ostreatus manganese‐dependent peroxidase silencing impairs decolourization of Orange II

  2009cites this paper
• Investigation of limonene synthase quality articulation in various organs just as the impact of manganese on articulation of this quality in Cuminum cyminum L.

  year unknowncites this paper