Manganese peroxidase gene transcription in Phanerochaete chrysosporium: activation by manganese

No abstract is available for this paper.

• Publication year

  1991

• Venue

  Journal of Bacteriology

• Publication date

  1991-07-01

• Fields of study

  Biology, Medicine, Environmental Science

• Identifiers
  DOI 10.1128/jb.173.13.4101-4106.1991PMID 2061289PMCID PMC208059
• External record

  Open on Semantic Scholar

• Source metadata

  Semantic Scholar, PubMed

• No claims are published for this paper.

• No concepts are published for this paper.

• Activation of a manganese-dependent membrane protein kinase by serine and tyrosine phosphorylation.

  1990cited by this paper
• Metalloregulatory proteins and molecular mechanisms of heavy metal signal transduction.

  1990cited by this paper
• Manganese regulates expression of manganese peroxidase by Phanerochaete chrysosporium

  1990cited by this paper
• Regulation of metallothionein gene transcription by metals.

  1990influential reference
• Mn(II) Regulation of Lignin Peroxidases and Manganese-Dependent Peroxidases from Lignin-Degrading White Rot Fungi

  1990influential reference
• Characterization of a gene encoding a manganese peroxidase from Phanerochaete chrysosporium.

  1990cited by this paper
• Extracellular peroxidases involved in lignin degradation by the white rot basidiomycete Phanerochaete chrysosporium

  1989cited by this paper
• Metalloregulatory Proteins: Metal Responsive Molecular Switches Governing Gene Expression

  1989cited by this paper
• Manganese-dependent peroxidase from Phanerochaete chrysosporium. Primary structure deduced from cDNA sequence.

  1989cited by this paper
• Manganese peroxidase from the lignin-degrading basidiomycete Phanerochaete chrysosporium. Transient state kinetics and reaction mechanism.

  1989cited by this paper
• Transformation by Complementation of an Adenine Auxotroph of the Lignin-Degrading Basidiomycete Phanerochaete chrysosporium

  1989cited by this paper
• Oxidative cleavage of a phenolic diarylpropane lignin model dimer by manganese peroxidase from Phanerochaete chrysosporium

  1989cited by this paper
• Fine mapping of a mouse metallothionein gene metal response element

  1989cited by this paper
• Characterization of a cDNA encoding a manganese peroxidase, from the lignin-degrading basidiomycete Phanerochaete chrysosporium.

  1989cited by this paper
• Nucleotide sequence of a ligninase gene from Phanerochaete chrysosporium.

  1988cited by this paper
• Molecular analysis of a Phanerochaete chrysosporium lignin peroxidase gene.

  1988cited by this paper
• Manganese peroxidase from the basidiomycete Phanerochaete chrysosporium: spectral characterization of the oxidized states and the catalytic cycle.

  1988cited by this paper
• Copper activates metallothionein gene transcription by altering the conformation of a specific DNA binding protein.

  1988cited by this paper
• A Specific Transport System for Manganese in the Filamentous Fungus Aspergillus niger

  1987cited by this paper
• The Neurospora crassa metallothionein gene. Regulation of expression and chromosomal location.

  1987cited by this paper
• Cloning and sequencing of a cDNA for a ligninase from Phanerochaete chrysosporium

  1987cited by this paper
• Homology among multiple extracellular peroxidases from Phanerochaete chrysosporium.

  1987cited by this paper
• Nucleotide sequence and organization of the rat heme oxygenase gene.

  1987cited by this paper
• Insulin stimulates a novel Mn2+-dependent cytosolic serine kinase in rat adipocytes.

  1987cited by this paper
• Enzymatic "combustion": the microbial degradation of lignin.

  1987influential reference
• Mating System and Basidiospore Formation in the Lignin-Degrading Basidiomycete Phanerochaete chrysosporium

  1987cited by this paper
• Cloning and sequencing of a cDNA for a ligninase from Phanerochaete chrysosporium

  1987cited by this paper
• Analysis of nucleotide sequences of two ligninase cDNAs from a white-rot filamentous fungus, Phanerochaete chrysosporium.

  1987cited by this paper
• Organization, expression, and evolution of genes for mercury resistance.

  1986cited by this paper
• Comparison of ligninase-I and peroxidase-M2 from the white-rot fungus Phanerochaete chrysosporium.

  1986cited by this paper
• The Specific Uptake of Manganese in the Yeast Candida utilis

  1986cited by this paper
• Mn(II) oxidation is the principal function of the extracellular Mn-peroxidase from Phanerochaete chrysosporium.

  1986cited by this paper
• Manganese and antibiotic biosynthesis. III. The site of manganese control of patulin production in Penicillium urticae.

  1986cited by this paper
• Chemistry of lignin biodegradation

  1985cited by this paper
• Purification and characterization of an extracellular Mn(II)-dependent peroxidase from the lignin-degrading basidiomycete, Phanerochaete chrysosporium.

  1985cited by this paper
• Separation and characterization of two extracelluar H2O2‐dependent oxidases from ligninolytic cultures of Phanerochaete chrysosporium

  1984cited by this paper
• A technique for radiolabeling DNA restriction endonuclease fragments to high specific activity.

  1983cited by this paper
• Induction of colonial growth and replica plating of the white rot basidiomycete Phanaerochaete chrysosporium

  1978cited by this paper
• Ligninolytic enzyme system of Phanaerochaete chrysosporium: synthesized in the absence of lignin in response to nitrogen starvation

  1978cited by this paper
• [Introduction to polyacrylamide gel electrophoresis].

  1975cited by this paper
• Purification of biologically active globin messenger RNA by chromatography on oligothymidylic acid-cellulose.

  1972cited by this paper
• Cleavage of Structural Proteins during the Assembly of the Head of Bacteriophage T4

  1970cited by this paper

• Gains in soil carbon storage under anthropogenic nitrogen deposition are rapidly lost following its cessation.

  2024cites this paper
• Manganese and soil organic carbon stability on a Hawaiian grassland rainfall gradient

  2024cites this paper
• Gains in soil C storage under anthropogenic N deposition are rapidly lost following its cessation

  2023cites this paper
• Functional Characterization of Melanin Decolorizing Extracellular Peroxidase of Bjerkandera adusta

  2021cites this paper
• The identification of ethanol and aromatic compounds from delignification of cacao pod husk using Phlebia sp.MG-60

  2021cites this paper
• Enzymatic Oxidation of Lignin: Challenges and Barriers Toward Practical Applications

  2020cites this paper
• Revealing the Features of the Oxidative Enzyme Production by White-Rot Basidiomycetes During Fermentation of Plant Raw Materials

  2020cites this paper
• Contribution of Lignin Peroxidase, Manganese Peroxidase, and Laccase in Lignite Degradation by Mixed White-Rot Fungi

  2020cites this paper
• Microbial Enzymes and Biotechniques: Interdisciplinary Perspectives

  2020cites this paper
• Genetic and metabolic engineering approaches for improving accessibilities of lignocellulosic biomass toward biofuels generations

  2020cites this paper
• Anthropogenic N deposition, fungal gene expression, and an increasing soil carbon sink in the Northern Hemisphere.

  2019cites this paper
• Kachia Military Shooting Range in situ Fungi SpeciesBiodegradation of Explosives, Kaduna, Nigeria

  2019cites this paper
• Regulation and Role of Metal Ions in Secondary Metabolite Production by Microorganisms

  2019cites this paper
• The importance of fermentative conditions for the biotechnological production of lignin modifying enzymes from white-rot fungi.

  2017cites this paper
• Studies of lignin modifying enzymes of a white rot fungus Ganoderma lucidum (P. karst) for their biotechnological application

  2016cites this paper
• Heterologous expression of a new manganese-dependent peroxidase gene from Peniophora incarnata KUC8836 and its ability to remove anthracene in Saccharomyces cerevisiae.

  2016cites this paper
• Biobleaching of Acacia kraft pulp with extracellular enzymes secreted by Irpex lacteus KB-1.1 and Lentinus tigrinus LP-7 using low-cost media

  2014cites this paper
• Biobleaching of Acacia kraft pulp with extracellular enzymes secreted by Irpex lacteus KB-1.1 and Lentinus tigrinus LP-7 using low-cost media

  2014cites this paper
• Bio-detoxification of Jatropha curcas seed cake by Pleurotus ostreatus

  2014cites this paper
• Advances in Enzyme Biotechnology

  2013cites this paper
• Microorganisms and Enzymes Involved in Lignin Degradation Vis-à-vis Production of Nutritionally Rich Animal Feed: An Overview

  2013cites this paper
• 5 Organopollutant Degradation by Wood Decay Basidiomycetes

  2013cites this paper
• Manganese Peroxidases: Molecular Diversity, Heterologous Expression, and Applications

  2013cites this paper
• Diversité fonctionelle des Glutation Transférases fongiques : caractérisation des classes Ure2p et GTT2 de Phanerochaete chrysosporium

  2013cites this paper
• Microbial Degradation of Lignocellulosic Biomass

  2013cites this paper
• Fungal laccase, manganese peroxidase and lignin peroxidase: gene expression and regulation.

  2013cites this paper
• Limonene synthase gene expression under different concentrations of manganese in Cuminum cyminum L.

  2012cites this paper
• Gene Primers 5 '-3 ' Product ( bp ) Limonene synthase Forward : GATGATATTTACGATGTCTATGGTAC 490 Reverse : GAATTGATTTCGGCACATCGCCTC-Tubulin synthase Forward : CAGCCAGATCTTCACGAGCTT 119 Reverse

  2012cites this paper
• Biological pretreatment of wheat straw by Phanerochaete chrysosporium supplemented with inorganic salts.

  2011cites this paper
• Microbial responses to a changing environment: implications for the future functioning of terrestrial ecosystems

  2011cites this paper
• Delignification Process of Agro-Industrial Wastes an Alternative to Obtain Fermentable Carbohydrates for Producing Fuel

  2011cites this paper
• Biological pretreatment of lignocelluloses with white-rot fungi and its applications: A review

  2011cites this paper
• Effect of manganese on the secretion of manganese-peroxidase by the basidiomycete Ceriporiopsis subvermispora.

  2010influential citation
• Biodelignification of rice straw by Phanerochaete chrysosporium in the presence of dirhamnolipid

  2010cites this paper
• Structure and Action Mechanism of Ligninolytic Enzymes

  2009cites this paper
• Aproximaciones a la comprensión de la degradación de la lignina

  2009cites this paper
• Analysis of manganese-regulated gene expression in the ligninolytic basidiomycete Ceriporiopsis subvermispora

  2008cites this paper
• Wood-inhabiting ligninolytic basidiomycetes in soils: Ecology and constraints for applicability in bioremediation

  2008cites this paper
• Manganese affects the production of laccase in the basidiomycete Ceriporiopsis subvermispora.

  2007cites this paper
• Produção de Ligninases por Basidiomicetos Através de Fermentação em Estado Sólido, Caracterização e Aplicação das Enzimas

  2005cites this paper
• Transcriptional regulation of plant cell wall degradation by filamentous fungi.

  2005cites this paper
• Nitrogen regulation of lignin peroxidase and manganese-dependent peroxidase production is independent of carbon and manganese regulation in Phanerochaete chrysosporium

  2004cites this paper
• Toxicity of Polychlorobiphenyls and its Bioremediation

  2004cites this paper
• Wood Degradation by Brown-Rot and White-Rot Fungi

  2004cites this paper
• Novel Promoter Sequence Required for Manganese Regulation of Manganese Peroxidase Isozyme 1 Gene Expression in Phanerochaete chrysosporium

  2004cites this paper
• Manganese peroxidase gene of the perennial mushroomElfvingia applanata: cloning and evaluation of its relationship with lignin degradation

  2004cites this paper
• Isolation and transformation of uracil auxotrophs of the lignin-degrading basidiomycete Phanerochaete chrysosporium

  2004cites this paper
• Fungal Decomposition of Natural Aromatic Structures and Xenobiotics: A Review

  2004cites this paper
• Differential regulation of genes encoding manganese peroxidase (MnP) in the basidiomycete Ceriporiopsis subvermispora

  2003cites this paper
• Lignocellulose Affects Mn2+ Regulation of Peroxidase Transcript Levels in Solid-State Cultures of Pleurotus ostreatus

  2002cites this paper
• Binding of nuclear proteins to the promoter region of the laccase gene Cs-lcs1 from the basidiomycete Ceriporiopsis subvermispora

  2002cites this paper
• Molecular Genetics of Lignin-Degrading Fungi and Their Applications in Organopollutant Degradation

  2002cites this paper
• Differential Regulation of mnp2, a New Manganese Peroxidase-Encoding Gene from the Ligninolytic Fungus Trametes versicolor PRL 572

  2002influential citation
• Molecular biology and structure-function of lignin-degrading heme peroxidases

  2002cites this paper
• Fungal peroxidases: molecular aspects and applications.

  2002influential citation
• Transcript and activity levels of different Pleurotus ostreatus peroxidases are differentially affected by Mn2+.

  2001cites this paper
• Linkage analysis and lignin peroxidase gene expression in Phanerochaete chrysosporium

  2001cites this paper
• The Green Fluorescent Protein Gene Functions as a Reporter of Gene Expression in Phanerochaete chrysosporium

  2001cites this paper
• Effect of growth conditions on the production of manganese peroxidase by three strains of Bjerkandera adusta.

  2001cites this paper
• Oxidative mechanisms involved in lignin degradation by white-rot fungi.

  2001cites this paper
• Heterobasidion annosum and wood decay: Enzymology of cellulose, hemicellulose, and lignin degradation

  2000influential citation
• Influence of Cadmium and Mercury on Activities of Ligninolytic Enzymes and Degradation of Polycyclic Aromatic Hydrocarbons by Pleurotus ostreatus in Soil

  2000cites this paper
• A simple and rapid method to gain high amounts of manganese peroxidase with immobilized mycelium of the agaric white-rot fungus Clitocybula dusenii

  2000cites this paper
• Manganese peroxidase.

  2000cites this paper
• Manganese Deficiency Can Replace High Oxygen Levels Needed for Lignin Peroxidase Formation by Phanerochaete chrysosporium

  1999cites this paper
• Cloning and Characterization of a cDNA Encoding a Novel Extracellular Peroxidase from Trametes versicolor

  1999cites this paper
• Characterization of genes encoding two manganese peroxidases from the lignin-degrading fungus Dichomitus squalens(1).

  1999cites this paper
• Regulation of Peroxidase Transcript Levels in Liquid Cultures of the Ligninolytic Fungus Pleurotus eryngii

  1999cites this paper
• Removal of Aroclor 1254 by the white rot fungus Coriolus versicolor in the presence of different concentrations of Mn(IV)oxide

  1999cites this paper
• Cloning and molecular analysis of a cDNA and the Cs-mnp1 gene encoding a manganese peroxidase isoenzyme from the lignin-degrading basidiomycete Ceriporiopsis subvermispora.

  1998cites this paper
• Expression of Phanerochaete chrysosporium Genes Encoding Lignin Peroxidases, Manganese Peroxidases, and Glyoxal Oxidase in Wood

  1998cites this paper
• Veratryl alcohol : mechanism of oxidation by lignin peroxidase and role in lignin degradation

  1998cites this paper
• Reverse Transcription-PCR Analysis of the Regulation of the Manganese Peroxidase Gene Family

  1998influential citation
• Characterization of a Novel Manganese Peroxidase-Lignin Peroxidase Hybrid Isozyme Produced by Bjerkandera Species Strain BOS55 in the Absence of Manganese*

  1998cites this paper
• Role of manganese and veratryl alcohol in the ligninolytic system of Bjerkandera sp. strain BOS55

  1998cites this paper
• Trametes versicolor from Encoding a Novel Extracellular Peroxidase Cloning and Characterization of a cDNA

  1998cites this paper
• Differential Gene Expression in the Laccase Gene Family from Basidiomycete I-62 (CECT 20197)

  1998cites this paper
• Truncated-gene reporter system for studying the regulation of manganese peroxidase expression

  1997cites this paper
• Regulation of Laccase Gene Transcription in Trametes versicolor

  1997cites this paper
• Recent advances on the molecular genetics of ligninolytic fungi.

  1997cites this paper
• Effect of nutrient nitrogen and manganese on manganese peroxidase and laccase production by Pleurotus sajor‐caju

  1997cites this paper
• Characterization of the gene encoding manganese peroxidase isozyme 3 from Phanerochaete chrysosporium.

  1997cites this paper
• Optimization of manganese peroxidase production by the white rot fungus Bjerkandera sp. strain BOS55

  1997cites this paper
• Manganese Is Not Required for Biobleaching of Oxygen-Delignified Kraft Pulp by the White Rot Fungus Bjerkandera sp. Strain BOS55

  1997cites this paper
• Expression, structure and mechanism of manganese peroxidase from Phanerochaete chrysosporium

  1997cites this paper
• Use of lignin degrading fungi in bioremediation

  1997cites this paper
• Purification and characterization of two manganese peroxidase isozymes from the white-rot basidiomycete Dichomitus squalens.

  1996cites this paper
• A cluster of genes encoding major isozymes of lignin peroxidase and manganese peroxidase from the white-rot fungus Trametes versicolor.

  1996cites this paper
• The ligninolytic system of the white rot fungus Pycnoporus cinnabarinus: purification and characterization of the laccase

  1996influential citation
• Manganese and malonate are individual regulators for the production of lignin and manganese peroxidase isozymes and in the degradation of lignin by Phlebia radiata

  1996influential citation
• Enzymology and Molecular Biology of Lignin Degradation

  1996cites this paper
• A Field Fungus Bjerkandera sp . Strain BOS 55 . Oxygen-Delignified Kraft Pulp by the White Rot Manganese Is Not Required for Biobleaching of

  1996cites this paper
• Manganese-Dependent Cleavage of Nonphenolic Lignin Structures by Ceriporiopsis subvermispora in the Absence of Lignin Peroxidase

  1996cites this paper
• Lignocellulose degradation by Phanerochaete chrysosporium: gene families and gene expression for a complex process

  1996cites this paper
• Lignocellulolytic enzyme profiles of edible mushroom fungi

  1996cites this paper
• Characterization of an intracellular quinone reductase from Phanerochaete chysosporium

  1996cites this paper
• Genetics and Biotechnology

  1995cites this paper
• Regulation of manganese peroxidase gene transcription by hydrogen peroxide, chemical stress, and molecular oxygen

  1995influential citation
• Effect of nutrient nitrogen and manganese on manganese peroxidase and laccase production by Lentinula (Lentinus) edodes

  1995cites this paper
• Manganese regulation of veratryl alcohol in white rot fungi and its indirect effect on lignin peroxidase

  1995cites this paper