Cadmium resistance from Staphylococcus aureus plasmid pI258 cadA gene results from a cadmium-efflux ATPase.

No abstract is available for this paper.

• Publication year

  1989

• Venue

  Proceedings of the National Academy of Sciences of the United States of America

• Publication date

  1989-05-01

• Fields of study

  Biology, Medicine, Chemistry, Environmental Science

• Identifiers
  DOI 10.1073/PNAS.86.10.3544PMID 2524829PMCID PMC287174
• External record

  Open on Semantic Scholar

• Source metadata

  Semantic Scholar, PubMed

• No claims are published for this paper.

• No concepts are published for this paper.

• Bacterial resistance ATPases: primary pumps for exporting toxic cations and anions.

  1989cited by this paper
• Plasmid-mediated heavy metal resistances.

  1988cited by this paper
• IS431, a staphylococcal insertion sequence-like element related to IS26 from Proteus vulgaris.

  1987cited by this paper
• DNA sequencing: a new strategy to create ordered deletions, modified M13 vector, and improved reaction conditions for sequencing by dideoxy chain termination method.

  1987cited by this paper
• Nucleotide sequence and expression of the mercurial-resistance operon from Staphylococcus aureus plasmid pI258.

  1987cited by this paper
• Cloning of the K+-ATPase of Streptococcus faecalis. Structural and evolutionary implications of its homology to the KdpB-protein of Escherichia coli.

  1987cited by this paper
• Resistance to mercury and to cadmium in chromosomally resistant Staphylococcus aureus

  1986cited by this paper
• Reconstitution of ATP-dependent calcium transport from streptococci.

  1986cited by this paper
• Hypothesis about the function of membrane-buried proline residues in transport proteins.

  1986cited by this paper
• Two Ca2+ ATPase genes: homologies and mechanistic implications of deduced amino acid sequences.

  1986cited by this paper
• Primary structure of the Neurospora plasma membrane H+-ATPase deduced from the gene sequence. Homology to Na+/K+-, Ca2+-, and K+-ATPase.

  1986cited by this paper
• Nucleotide sequence of the enterotoxin B gene from Staphylococcus aureus

  1986cited by this paper
• Use of bacteriophage T7 RNA polymerase to direct selective high-level expression of cloned genes.

  1986cited by this paper
• Amino-acid sequence of a Ca2++Mg2+-dependent ATPase from rabbit muscle sarcoplasmic reticulum, deduced from its complementary DNA sequence

  1985cited by this paper
• Rapid and sensitive protein similarity searches.

  1985cited by this paper
• Amino-acid sequence of a Ca2+ + Mg2+ -dependent ATPase from rabbit muscle sarcoplasmic reticulum, deduced from its complementary DNA sequence

  1985cited by this paper
• Amino-acid sequence of the catalytic subunit of the (Na+ + K+)ATPase deduced from a complementary DNA

  1985cited by this paper
• Cadmium-resistant mutant of Bacillus subtilis 168 with reduced cadmium transport

  1985cited by this paper
• Sequence homology between two membrane transport ATPases, the Kdp-ATPase of Escherichia coli and the Ca2+-ATPase of sarcoplasmic reticulum.

  1984cited by this paper
• Purification of a putative K+-ATPase from Streptococcus faecalis.

  1983cited by this paper
• Conformational changes of the Neurospora plasma membrane H+ATPase during its catalytic cycle.

  1982cited by this paper
• Cadmium and manganese transport in Staphylococcus aureus membrane vesicles

  1982cited by this paper
• Energy-dependent efflux of cadmium coded by a plasmid resistance determinant in Staphylococcus aureus

  1981cited by this paper
• Reduced cadmium transport determined by a resistance plasmid in Staphylococcus aureus

  1981cited by this paper
• Penicillinase plasmids of Staphylococcus aureus: restriction-deletion maps.

  1979cited by this paper
• Cation Transport Alteration Associated with Plasmid-Determined Resistance to Cadmium in Staphylococcus aureus

  1978cited by this paper
• Fate of Transforming Deoxyribonucleic Acid After Uptake by Competent Bacillus subtilis: Phenotypic Characterization of Radiation-Sensitive Recombination-Deficient Mutants

  1973cited by this paper
• Four gel systems for electrophoretic fractionation of membrane proteins using ionic detergents.

  1972cited by this paper

• Combining cyanobacteria biocrust and biochar for immobilization of Cd in the collected soil surrounding tailing areas in semi-arid northwest China

  2025cites this paper
• Domain antibody–displayed phages as a novel biofilm-targeted therapy for Staphylococcus aureus

  2025cites this paper
• High‐Throughput Tn‐Seq Screens Identify Both Known and Novel Pseudomonas putida KT2440 Genes Involved in Metal Tolerance

  2025cites this paper
• A novel Zn (II)/Cd (II)/Pb (II)-translocating PIB-type ATPase mediates metal resistance in Chryseobacterium sp. strain PMSZPI in metal-enriched soil of uranium ore deposit.

  2025cites this paper
• Unraveling the genetic basis of microbial metal resistance: Shift from mendelian to systems biology.

  2025cites this paper
• Exchangeable heavy metals promote the proliferation of metal resistance genes by influencing microbial communities

  2025cites this paper
• Antibiotic and Heavy Metal Resistance in Bacteria from Contaminated Agricultural Soil: Insights from a New Zealand Airstrip

  2025cites this paper
• Ultra-sensitive water contaminant detection with transcription factor interfaced microcantilevers

  2024cites this paper
• The cadDX operon contributes to cadmium resistance, oxidative stress resistance, and virulence in zoonotic streptococci

  2024cites this paper
• Multimodal cadmium resistance and its regulatory networking in Pseudomonas aeruginosa strain CD3

  2024cites this paper
• Heavy Metal and Antibiotic Co-resistance in Bacteria Isolated from Poultry Samples in Bangladesh: An Emerging Environmental Threat

  2024cites this paper
• Bacterial Homeostasis and Tolerance to Potentially Toxic Metals and Metalloids through Diverse Transporters: Metal-Specific Insights

  2024cites this paper
• Isolation of heavy metal resistant Staphylococcus epidermidis strain TWSL_22 and evaluation of heavy metal bioremediation potential of recombinant E. coli cloned with isolated cadD.

  2023cites this paper
• A review of biosensor for environmental monitoring: principle, application, and corresponding achievement of sustainable development goals

  2023cites this paper
• Cadmium-tolerant Bacillus cereus 2-7 alleviates the phytotoxicity of cadmium exposure in banana plantlets.

  2023cites this paper
• A Cell-free Protein Synthesis Method for the Detection of Heavy Metal Ions Using a Personal Glucose Meter

  2023cites this paper
• Plant growth-promoting and heavy metal-resistant Priestia and Bacillus strains associated with pioneer plants from mine tailings

  2023cites this paper
• Sequestration and efflux largely account for cadmium and copper resistance in the deep‐sea Nitratiruptor sp. SB155‐2 (phylum Campylobacterota)

  2022cites this paper
• Genomic Insights Into Cadmium Resistance of a Newly Isolated, Plasmid-Free Cellulomonas sp. Strain Y8

  2022cites this paper
• Widespread bacterial responses and their mechanism of bacterial metallogenic detoxification under high concentrations of heavy metals.

  2022cites this paper
• Molecular Mechanisms Underlying Bacterial Uranium Resistance

  2022cites this paper
• Complete Genome Sequence of Micrococcus luteus Strain CW.Ay, Isolated from Indoor Air in a Hong Kong School

  2022cites this paper
• Longitudinal physiological and transcriptomic analyses reveal the short term and long term response of Synechocystis sp. PCC6803 to cadmium stress.

  2022cites this paper
• The efficacy of Staphylococcus aureus dry biomass in the detection of Cd(II) heavy metal ions

  2022cites this paper
• Bacillus megaterium HgT21: a Promising Metal Multiresistant Plant Growth-Promoting Bacteria for Soil Biorestoration

  2022cites this paper
• Bio- and phytoremediation: plants and microbes to the rescue of heavy metal polluted soils

  2022cites this paper
• Potential of cadmium resistant Burkholderia contaminans strain ZCC in promoting growth of soy beans in the presence of cadmium.

  2021cites this paper
• Sequestration and efflux largely account for cadmium and copper resistance in the deep sea epsilonproteobacterium, Nitratiruptor sp. SB155-2

  2021cites this paper
• Characterization of a Bacillus megaterium strain with metal bioremediation potential and in silico discovery of novel cadmium binding motifs in the regulator, CadC

  2021cites this paper
• The Microbiology of Metal Mine Waste: Bioremediation Applications and Implications for Planetary Health

  2021cites this paper
• Heavy Metals in Soils and the Remediation Potential of Bacteria Associated With the Plant Microbiome

  2021cites this paper
• Characterization of a Multi-Metal Resistant Bacillus cereus Strain TWSL_5 and it’s Bioremediation Potential for Cr, Pb, Zn and Fe

  2021cites this paper
• Bioremediation of heavy metals from wastewater treatment plants by microorganisms

  2021cites this paper
• An operon consisting of a P-type ATPase gene and a transcriptional regulator gene responsible for cadmium resistances in Bacillus vietamensis 151-6 and Bacillus maris�avi 151-25

  2021cites this paper
• An operon consisting of a P-type ATPase gene and a transcriptional regulator gene responsible for cadmium resistances in Bacillus vietamensis 151-6 and Bacillus maris�avi 151-25

  2021cites this paper
• Remediation of Heavy Metals Through Genetically Engineered Microorganism

  2021cites this paper
• Dynamics of Antibacterial Drone Establishment in Staphylococcus aureus: Unexpected Effects of Antibiotic Resistance Genes

  2021cites this paper
• Cadmium‐tolerant bacteria: current trends and applications in agriculture

  2021cites this paper
• Genetic system underlying responses of Cryptococcus neoformans to cadmium

  2021cites this paper
• Cadmium transport activity of four mercury transporters (MerC, MerE, MerF, and MerT) and effects of the periplasmic mercury-binding protein MerP on Mer-dependent cadmium uptake.

  2020cites this paper
• Effects of cadmium perturbation on the microbial community structure and heavy metal resistome of a tropical agricultural soil

  2020cites this paper
• Recent advances in exploring the heavy metal(loid) resistant microbiome

  2020cites this paper
• The CzcCBA Efflux System Requires the CadA P-Type ATPase for Timely Expression Upon Zinc Excess in Pseudomonas aeruginosa

  2020cites this paper
• Biochemical and biodiversity insights into heavy metal ion-responsive transcription regulators for synthetic biological heavy metal sensors.

  2019cites this paper
• Response of the biomining Acidithiobacillus ferrooxidans to high cadmium concentrations.

  2019cites this paper
• Resistance to Metals Used in Agricultural Production

  2019cites this paper
• An operon consisting of a P-type ATPase gene and a transcriptional regulator gene responsible for cadmium resistances in Bacillus vietamensis 151–6 and Bacillus marisflavi 151–25

  2019cites this paper
• Biostimulation potentials of corn steep liquor in enhanced hydrocarbon degradation in chronically polluted soil

  2019cites this paper
• Functional Metagenomics to Mine Soil Microbiome for Novel Cadmium Resistance Genetic Determinants

  2019cites this paper
• An operon consisting of a P-type ATPase gene and a transcriptional regular gene given the different cadmium resistances in Bacillus vietamensis 151-6 and Bacillus marisflavi 151-25

  2019influential citation
• Comparative Analysis of Listeria monocytogenes Plasmids and Expression Levels of Plasmid-Encoded Genes during Growth under Salt and Acid Stress Conditions

  2019cites this paper
• Detection of a plasmid containing Cadmium resistance gene for lactic acid bacteria isolated from foods

  2019cites this paper
• Methicillin-resistant Staphylococcus pseudintermedius among dogs in the description of novel SCCmec variants.

  2018cites this paper
• Homology modeling and in vivo functional characterization of the zinc permeation pathway in a heavy metal P-type ATPase

  2018cites this paper
• di-Cysteine motifs in the C-terminus of plant HMA4 proteins confer nanomolar affinity for zinc and are essential for HMA4 function in vivo

  2018cites this paper
• Complete genome sequence of soil actinobacteria Streptomyces cavourensis TJ430

  2018cites this paper
• Bio-prospectus of cadmium bioadsorption by lactic acid bacteria to mitigate health and environmental impacts

  2018cites this paper
• Resistance to Metals Used in Agricultural Production

  2018cites this paper
• Listeria monocytogenes CadC Regulates Cadmium Efflux and Fine-tunes Lipoprotein Localization to Escape the Host Immune Response and Promote Infection

  2017cites this paper
• The P-type ATPase CtpG preferentially transports Cd2+ across the Mycobacterium tuberculosis plasma membrane

  2017cites this paper
• Ferrous iron efflux systems in bacteria.

  2017cites this paper
• Isolation and biochemical characterization of heavy-metal resistant bacteria from tannery effluent in Chittagong city, Bangladesh: Bioremediation viewpoint

  2017cites this paper
• Bioremediation of Heavy Metals by Microbes

  2017cites this paper
• Killing of bacteria by copper, cadmium, and silver surfaces reveals relevant physicochemical parameters.

  2017cites this paper
• Role of Plasmids in Microbiology

  2017cites this paper
• Metagenomic insights into effects of spent engine oil perturbation on the microbial community composition and function in a tropical agricultural soil

  2017cites this paper
• Development of cadmium specific recombinant biosensor and its application in milk samples

  2017cites this paper
• Identification of key proteins and pathways in cadmium tolerance of Lactobacillus plantarum strains by proteomic analysis

  2017cites this paper
• Elucidation of novel physiological and genetic elements associated with the cold adaptability and survival of Listeria monocytogenes in the food processing continuum

  2017cites this paper
• Metal homeostasis in bacteria: the role of ArsR–SmtB family of transcriptional repressors in combating varying metal concentrations in the environment

  2017cites this paper
• A comparative review towards potential of microbial cells for heavy metal removal with emphasis on biosorption and bioaccumulation

  2016cites this paper
• Cd2+ extrusion by P-type Cd2+-ATPase of Staphylococcus aureus 17810R via energy-dependent Cd2+/H+ exchange mechanism

  2016influential citation
• A broad host range food-grade cloning vector for lactic acid bacteria

  2016cites this paper
• A comparative review towards potential of microbial cells for heavy metal removal with emphasis on biosorption and bioaccumulation

  2016cites this paper
• Study of Genetic Determinants of Nickel and Cadmium Resistance in Bacteria-A Review

  2016cites this paper
• The copper rush of the nineties.

  2016cites this paper
• Structural and Functional Characterization of the Putative Pineal ATPase PINA

  2016cites this paper
• Genetic basis and importance of metal resistant genes in bacteria for bioremediation of contaminated environments with toxic metal pollutants

  2016cites this paper
• Cd-Resistant Strains of B. cereus S5 with Endurance Capacity and Their Capacities for Cadmium Removal from Cadmium-Polluted Water

  2016cites this paper
• Biodegradation of petroleum hydrocarbons in soils co-contaminated with petroleum hydrocarbons and heavy metals derived from petroleum

  2016cites this paper
• Use of cadA-Specific Primers and DNA Probes as Tools to Select Cadmium Biosorbents with Potential in Remediation Strategies

  2016cites this paper
• Isolation and characterization of heavy metal resistant psychrotrophs from antarctica

  2016cites this paper
• Plasmid-Borne Antimicrobial Resistance of Staphylococcus aureus Isolated in a Hospital in Lisbon, Portugal

  2016cites this paper
• A Ferrous Iron Exporter Mediates Iron Resistance in Shewanella oneidensis MR-1

  2015cites this paper
• Rhizobial strains isolated from nodules of Medicago marina in southwest Spain are abiotic-stress tolerant and symbiotically diverse.

  2015cites this paper
• Functional characterization of a cadmium resistance operon in Staphylococcus aureus ATCC12600: CadC does not function as a repressor

  2015cites this paper
• Transcriptomic Response of Enterococcus faecalis V583 to Low Hydrogen Peroxide Levels

  2015cites this paper
• MOLECULAR INVESTIGATION OF CADMIUM RESPONSE IN AN ENVIRONMENTAL PSEUDOMONAS ISOLATE

  2015cites this paper
• A SNP-based method for determining the origin of MRSA isolates

  2015cites this paper
• CompR GTACACTAGTGGCATAACCACTCCTTTGATTG SpeI ECfieFUSF GATCACTAGTCGATACCATTTTTCTTCGGC SpeI ECfieFUSR GATCCCGCGGCATAAATACTCCCGCTATCAAC SacII ECfieFDSF GATCCCGCGGCGGTCTATGCTTTCATAATCAG SacII ECfieFDSR GATCGGATCCCATACGGGAAGCCAGAATAC BamHI ECfiefF GTACGGATCCCAATTTGCCTGCTGCTTAATGC BamHI ECfiefR GTACACTAGT

  2015cites this paper
• Resistance of Pseudomonas Aeruginosa From Clinical and Environmental Sources to Heavy Metals in Hilla City, Iraq

  2014cites this paper
• Metal–Microbe Interaction and Bioremediation

  2014cites this paper
• CadA of Mesorhizobium metallidurans isolated from a zinc-rich mining soil is a P(IB-2)-type ATPase involved in cadmium and zinc resistance.

  2014cites this paper
• Carbazole angular dioxygenation and mineralization by bacteria isolated from hydrocarbon-contaminated tropical African soil

  2014cites this paper
• Copper homeostasis and Salmonella pathogenicity : interplay with resistance to nitrosative stress

  2014cites this paper
• Bioremediation of hexavalent chromium using gram-negative bacteria.

  2014cites this paper
• Characterization and cadmium-resistant gene expression of biofilm-forming marine bacterium Pseudomonas aeruginosa JP-11

  2014cites this paper
• Radionuclide Contamination and Remediation Through Plants

  2014cites this paper
• Strain-specific bioaccumulation and intracellular distribution of Cd2+ in bacteria isolated from the rhizosphere, ectomycorrhizae, and fruitbodies of ectomycorrhizal fungi

  2014cites this paper
• Diversity of the metal-transporting P1B-type ATPases

  2014cites this paper