A Plant Caspase-Like Protease Activated during the Hypersensitive Response Article, publication date, and citation information can be found at www.plantcell.org/cgi/doi/10.1105/tpc.017889.

No abstract is available for this paper.

• Publication year

  2004

• Venue

  The Plant Cell Online

• Publication date

  2004-01-01

• Fields of study

  Biology, Medicine, Environmental Science

• Identifiers
  DOI 10.1105/tpc.017889PMID 14660804PMCID PMC301402
• External record

  Open on Semantic Scholar

• Source metadata

  Semantic Scholar, PubMed

• No claims are published for this paper.

• No concepts are published for this paper.

• Expression of the baculovirus p35 protein in tobacco affects cell death progression and compromises N gene-mediated disease resistance response to Tobacco mosaic virus.

  2003cited by this paper
• Apoptosis-related fragmentation, translocation, and properties of human prothymosin alpha.

  2003influential reference
• Multiple mediators of plant programmed cell death: Interplay of conserved cell death mechanisms and plant‐specific regulators

  2003cited by this paper
• Activation of caspase-like proteases and induction of apoptosis by isopentenyladenosine in tobacco BY-2 cells

  2002cited by this paper
• Constitutive caspase-like machinery executes programmed cell death in plant cells

  2002cited by this paper
• Programmed cell death, mitochondria and the plant hypersensitive response

  2001cited by this paper
• Abrogation of disease development in plants expressing animal antiapoptotic genes

  2001cited by this paper
• The PET 1-CMS Mitochondrial Mutation in Sunflower Is Associated with Premature Programmed Cell Death and Cytochrome c Release

  2001cited by this paper
• The mitochondrial apoptosome: a killer unleashed by the cytochrome seas.

  2001cited by this paper
• Import of Agrobacterium T-DNA into Plant Nuclei: Two Distinct Functions of VirD2 and VirE2 Proteins

  2001cited by this paper
• The PET1-CMS Mitochondrial Mutation in Sunflower Is Associated with Premature Programmed Cell Death and Cytochrome c Release

  2001cited by this paper
• Programmed cell death: alive and well in the new millennium.

  2001cited by this paper
• Plant programmed cell death: a common way to die.

  2000cited by this paper
• Hypersensitive response-related death

  2000cited by this paper
• NO way back: nitric oxide and programmed cell death in Arabidopsis thaliana suspension cultures.

  2000influential reference
• Identification of paracaspases and metacaspases: two ancient families of caspase-like proteins, one of which plays a key role in MALT lymphoma.

  2000cited by this paper
• Involvement of poly(ADP‐ribose) polymerase and activation of caspase‐3‐like protease in heat shock‐induced apoptosis in tobacco suspension cells

  2000cited by this paper
• Evidence for Agrobacterium-induced apoptosis in maize cells.

  2000influential reference
• Caspase-like protease involvement in the control of plant cell death

  2000cited by this paper
• Cleavage of lamin‐like proteins in in vivo and in vitro apoptosis of tobacco protoplasts induced by heat shock

  2000cited by this paper
• AtBI-1, a plant homologue of Bax inhibitor-1, suppresses Bax-induced cell death in yeast and is rapidly upregulated during wounding and pathogen challenge.

  2000cited by this paper
• Caspase inhibitors

  1999cited by this paper
• Caspase knockouts: matters of life and death

  1999cited by this paper
• The Involvement of Cysteine Proteases and Protease Inhibitor Genes in the Regulation of Programmed Cell Death in Plants

  1999cited by this paper
• Heterologous sequences greatly affect foreign gene expression in tobacco mosaic virus-based vectors.

  1999cited by this paper
• Cytochrome c release and caspase activation during menadione‐induced apoptosis in plants

  1999cited by this paper
• Animal cell-death suppressors Bcl-x(L) and Ced-9 inhibit cell death in tobacco plants.

  1999cited by this paper
• Programmed cell death in castor bean endosperm is associated with the accumulation and release of a cysteine endopeptidase from ricinosomes.

  1999cited by this paper
• Suicidal Tendencies: Apoptotic Cell Death by Caspase Family Proteinases*

  1999cited by this paper
• Bax-induced cell death in tobacco is similar to the hypersensitive response.

  1999cited by this paper
• Development and applications of enhanced green fluorescent protein mutants.

  1998cited by this paper
• Caspases and programmed cell death in the hypersensitive response of plants to pathogens.

  1998influential reference
• Activation of cysteine proteases in cowpea plants during the hypersensitive response--a form of programmed cell death.

  1998cited by this paper
• Apoptotic pathways: the roads to ruin.

  1998cited by this paper
• Apoptotic Pathways: The Roads to Ruin

  1998cited by this paper
• Caspases: enemies within.

  1998cited by this paper
• Substrate Specificities of Caspase Family Proteases*

  1997cited by this paper
• PROGRAMMED CELL DEATH IN PLANT-PATHOGEN INTERACTIONS.

  1997cited by this paper
• Programmed cell death: a way of life for plants.

  1996cited by this paper
• The Agrobacterium tumefaciens virulence D2 protein is responsible for precise integration of T‐DNA into the plant genome.

  1995cited by this paper
• Transient and specific expression of a cysteine endopeptidase associated with autolysis during differentiation of Zinnia mesophyll cells into tracheary elements.

  1995cited by this paper
• hsr203J, a tobacco gene whose activation is rapid, highly localized and specific for incompatible plant/pathogen interactions.

  1994cited by this paper
• The VirD2 protein of A. tumefaciens contains a C-terminal bipartite nuclear localization signal: implications for nuclear uptake of DNA in plant cells.

  1992influential reference
• A nuclear localization signal and the C-terminal omega sequence in the Agrobacterium tumefaciens VirD2 endonuclease are important for tumor formation.

  1992cited by this paper
• VirD2 gene product from the nopaline plasmid pTiC58 has at least two activities required for virulence.

  1990cited by this paper
• Covalently bound VirD2 protein of Agrobacterium tumefaciens protects the T-DNA from exonucleolytic degradation.

  1989cited by this paper
• VirD2 Protein of Agrobacterium tumefaciens Very Tightly Linked to the 5' End of T-Strand DNA

  1988cited by this paper
• Tricine-sodium dodecyl sulfate-polyacrylamide gel electrophoresis for the separation of proteins in the range from 1 to 100 kDa.

  1987cited by this paper
• The virD operon of Agrobacterium tumefaciens encodes a site-specific endonuclease.

  1986cited by this paper
• Programmed cell death.

  1974cited by this paper
• Apoptosis: A Basic Biological Phenomenon with Wide-ranging Implications in Tissue Kinetics

  1972cited by this paper
• Cleavage of Structural Proteins during the Assembly of the Head of Bacteriophage T4

  1970cited by this paper
• SOME EFFECTS OF HIGH TEMPERATURE ON THE SUSCEPTIBILITY OF PLANTS TO INFECTION WITH VIRUSES

  1952cited by this paper

• Retrograde Transport of Tobacco Phytaspase Is Mediated by Its Partner, Tubby-like F-Box Protein 8

  2025cites this paper
• Cellular nitro-oxidative burden and survival through regulated cell death in the plants

  2025cites this paper
• Investigation of a phytaspase activity from Nicotiana benthamiana: purification, identification, and characterization

  2025cites this paper
• Characterization of Phytaspase Proteolytic Activity Using Fluorogenic Peptide Substrates.

  2024cites this paper
• Proteolysis in plant immunity.

  2024cites this paper
• Berry shrivel in grapevine: a review considering multiple approaches

  2024cites this paper
• Purification of Phytaspases Using a Biotinylated Peptide Inhibitor.

  2024cites this paper
• Phytaspase Does Not Require Proteolytic Activity for Its Stress-Induced Internalization

  2024cites this paper
• Ac-DEVD-CHO (caspase-3/DEVDase inhibitor) suppresses self-incompatibility–induced programmed cell death in the pollen tubes of petunia (Petunia hybrida E. Vilm.)

  2024cites this paper
• XCP1 cleaves Pathogenesis-related protein 1 into CAPE9 for systemic immunity in Arabidopsis

  2023cites this paper
• Phytaspase Is Capable of Detaching the Endoplasmic Reticulum Retrieval Signal from Tobacco Calreticulin-3

  2023influential citation
• Transcriptional Profiling of Resistant and Susceptible Cultivars of Grapevine (Vitis L.) Reveals Hypersensitive Responses to Plasmopara viticola

  2022cites this paper
• Chronological transcriptome changes induced by exposure to cyanoacrylate resin nanoparticles in Chlamydomonas reinhardtii with a focus on ROS development and cell wall lysis-related genes

  2022cites this paper
• The conservation of IAP-like proteins in fungi, and their potential role in fungal programmed cell death.

  2022cites this paper
• Identification of Phytaspase Interactors via the Proximity-Dependent Biotin-Based Identification Approach

  2021cites this paper
• Initiation and Execution of Programmed Cell Death and Regulation of Reactive Oxygen Species in Plants

  2021cites this paper
• The Rysto immune receptor recognises a broadly conserved feature of potyviral coat proteins

  2021influential citation
• XCP1 is a caspase that proteolyzes Pathogenesis-related protein 1 to produce the cytokine CAPE9 for systemic immunity in Arabidopsis

  2021cites this paper
• The role of alternative oxidase in plant hypersensitive response.

  2021cites this paper
• The front line of defence: a meta-analysis of apoplastic proteases in plant immunity

  2021cites this paper
• CORRECTION: RD19, an Arabidopsis cysteine protease required for RRS1-R-mediated resistance, is relocalized to the nucleus by the Ralstonia solanacearum PopP2 effector.

  2020cites this paper
• Clathrin-Mediated Endocytosis Delivers Proteolytically Active Phytaspases Into Plant Cells

  2019cites this paper
• Targeted expression of a cysteine protease (AdCP) in tapetum induces male sterility in Indian mustard, Brassica juncea

  2019cites this paper
• Flower Senescence: Present Status and Future Aspects

  2019cites this paper
• Programmed Cell Death in Seeds: An Adaptive Mechanism Required for Life

  2019cites this paper
• Sometimes they come back: endocytosis provides localization dynamics of a subtilase in cells committed to cell death

  2019cites this paper
• A VPE-like protease NtTPE8 exclusively expresses in the integumentary tapetum and is involved in seed development.

  2019cites this paper
• Host plant modifications to improve production of challenging heterologous proteins

  2019cites this paper
• Plant proteases in the control of the hypersensitive response.

  2019cites this paper
• Phytaspase-mediated precursor processing and maturation of the wound hormone systemin.

  2018cites this paper
• The cloak, dagger, and shield: proteases in plant-pathogen interactions.

  2018cites this paper
• Regulation of plant peptide hormones and growth factors by post-translational modification.

  2018cites this paper
• The tomato subtilase family includes several cell death-related proteinases with caspase specificity

  2018cites this paper
• Genome-Wide Exon-Capture Approach Identifies Genetic Variants of Norway Spruce Genes Associated With Susceptibility to Heterobasidion parviporum Infection

  2018cites this paper
• Indispensable Role of Proteases in Plant Innate Immunity

  2018cites this paper
• Analysis of Signal Transduction Pathways of Apoptotic Cell Death Induced by the Host-Specific Toxin, Victorin

  2018cites this paper
• Subtilisin-like proteases and lipid signalling events play an important role in grapevine resistance to downy mildew: a systems biology approach

  2018cites this paper
• From structure to function - a family portrait of plant subtilases.

  2018cites this paper
• Subtilisin-like proteases in plant defence: the past, the present and beyond.

  2018cites this paper
• Arabidopsis thaliana phytaspase: identification and peculiar properties.

  2018cites this paper
• Host Cell Proteome of Physcomitrella patens Harbors Proteases and Protease Inhibitors under Bioproduction Conditions.

  2018cites this paper
• Physiological mechanisms conferring ameliorative effects of nitric oxide and cytokinin on salinity stress tolerance in pea and barley

  2017influential citation
• The relationship between vacuolation and initiation of PCD in rice (Oryza sativa) aleurone cells

  2017cites this paper
• Arabidopsis thaliana serpins AtSRP4 and AtSRP5 negatively regulate stress-induced cell death and effector-triggered immunity induced by bacterial effector AvrRpt2.

  2017cites this paper
• Protease signaling in animal and plant‐regulated cell death

  2016cites this paper
• Revisiting Vitis vinifera subtilase gene family: links to grapevine resistance against Plasmopara viticola

  2016cites this paper
• Effects of exogenous H2O2 on the content of endogenous H2O2, activities of catalase and hydrolases, and cell ultrastructure in tobacco leaves

  2016cites this paper
• Manipulation of Programmed Cell Death Pathways Enhances Osmotic Stress Tolerance in Plants: Physiological and Molecular Insights

  2016cites this paper
• Drought Stress Tolerance in Plants, Vol 1

  2016cites this paper
• Estudio y caracterización funcional de efectores implicados en la interacción Colletotrichum graminicola-maíz

  2016cites this paper
• Caspase-like proteases regulate aluminum-induced programmed cell death in peanut

  2016cites this paper
• Effect of Exogenic Н2О2 on the Content of Endogenic Н2О2, the Activity of Catalase, Hydrolases, and on the Ultrastructure of Cells in Tobacco Leaves

  2015cites this paper
• Plant Proteases Involved in Regulated Cell Death

  2015cites this paper
• Pepper pathogenesis-related protein 4c is a plasma membrane-localized cysteine protease inhibitor that is required for plant cell death and defense signaling.

  2015influential citation
• Programmed cell death during development of cowpea (Vigna unguiculata (L.) Walp.) seed coat.

  2015cites this paper
• Programmed Cell Death Regulation by Plant Proteases with Caspase-Like Activity

  2015cites this paper
• Nuclear Dismantling Events: Crucial Steps During the Execution of Plant Programmed Cell Death

  2015cites this paper
• Hydrogen peroxide promotes programmed cell death and salicylic acid accumulation during the induced production of sesquiterpenes in cultured cell suspensions of Aquilaria sinensis.

  2015cites this paper
• Expression levels of ethylene biosynthetic genes and senescence-related genes in carnation (Dianthus caryophyllus L.) with ultra-long-life flowers

  2015cites this paper
• Programmed cell death: genes involved in signaling, regulation, and execution in plants and animals

  2015cites this paper
• Isolation and characterization of a Solanum tuberosum subtilisin-like protein with caspase-3 activity (StSBTc-3).

  2015cites this paper
• Role of phytochromes A and B in the regulation of cell death and acclimatory responses to UV stress in Arabidopsis thaliana

  2015cites this paper
• Substrate Specificity and Possible Heterologous Targets of Phytaspase, a Plant Cell Death Protease*

  2015influential citation
• Phytaspases: Aspartate-specific proteases involved in plant cell death

  2014cites this paper
• Genome-wide and molecular evolution analysis of the subtilase gene family in Vitis vinifera

  2014cites this paper
• Taking one for the team: self-recognition and cell suicide in pollen.

  2014cites this paper
• Biotechnological approaches to creation of hypoxia and anoxia tolerant plants

  2014cites this paper
• Isolation and characterization of a Solanum tuberosum subtilisin-like protein with caspase-3 activity ( St SBTc-3 )

  2014cites this paper
• EAT1 promotes tapetal cell death by regulating aspartic proteases during male reproductive development in rice

  2013cites this paper
• Mastoparan-induced programmed cell death in the unicellular alga Chlamydomonas reinhardtii.

  2013cites this paper
• Nitric oxide (NO) regulates the expression of single-domain cystatins in Glycine max (soybean).

  2013cites this paper
• Nitric oxide promotes MPK6-mediated caspase-3-like activation in cadmium-induced Arabidopsis thaliana programmed cell death.

  2013cites this paper
• Ultrastructure and hydrolase activity in tobacco leaves exposed to chitosan

  2013cites this paper
• XXXIV Appendix ATTTGGATCTGTTAATGCTTGCAGGGGCAGTCTGAAAGTGGCAGAACGCCACCAT GAACGCTTCGTACTTCTGAATCAAACATCCATCGTTGTCAATACCCCACATTCCA ACGCTATCAAGAAATTGTGCATTCGTAACTGCATTTCGGGAACTTACACAACCTG GGTAACGTTCAAGGACGAAGAAGAAGATAGCTGTACTGGACGATATTCTAACAC CCTCCGAAATGCAATTATTTTATATTATGTATGGTTAAGCGATGTATCCTCACAAG TCGAT

  2013cites this paper
• Morphological and biochemical characterization of Erwinia amylovora-induced hypersensitive cell death in apple leaves.

  2013cites this paper
• Analysis of the function of cathepsin B as a regulator of plant programmed cell death

  2013cites this paper
• Plant-Pathogen Interactions Associated with Wasting Disease in the Tropical Seagrass Thalassia testudinum.

  2013cites this paper
• Application of Non-invasive Microelectrode Flux Measurements in Plant Stress Physiology

  2012cites this paper
• Coffee cysteine proteinases and related inhibitors with high expression during grain maturation and germination

  2012cites this paper
• Plant phytaspases and animal caspases: structurally unrelated death proteases with a common role and specificity.

  2012cites this paper
• Subtilases - versatile tools for protein turnover, plant development, and interactions with the environment.

  2012influential citation
• Expression of the cell death protein CED-4 of Caenorhabditis elegans in transgenic tobacco plants confers resistance to Meloidogyne incognita

  2012cites this paper
• DEVDase activity is induced in potato leaves during Phytophthora infestans infection.

  2012influential citation
• A Global Microarray Expression Profile of Grapevine miRNAs Isolated from Cell Suspensions Pre-Treated with Apoptosis Activators

  2012cites this paper
• Genômica funcional da interação cacaueiro (Theobroma cacao L.) x Moniliophthora perniciosa por meio do sistema modelo Micro-Tom (Solanum lycopersicum L)

  2012cites this paper
• Programmed cell death in plants

  2012cites this paper
• Involvement of hsr203J like gene homologue, protease and protease inhibitors in triggering differential defense response against Alternaria blight in Brassica

  2011cites this paper
• The Botanical Dance of Death: Programmed Cell Death in Plants

  2011cites this paper
• NO, ROS, and cell death associated with caspase-like activity increase in stress-induced microspore embryogenesis of barley

  2011cites this paper
• Caspase substrates and cellular remodeling.

  2011cites this paper
• A subset of cells in tobacco mosaic virus (TMV)-induced local lesions in Datura stramonium leaves are tolerant to TMV

  2011cites this paper
• Abiotic Stress-Induced Programmed Cell Death in Plants: A Phytaspase Connection

  2011cites this paper
• A plant alternative to animal caspases: subtilisin-like proteases

  2011influential citation
• Signaling and Communication in Plants

  2011cites this paper
• Abiotic Stress Response in Plants - Physiological, Biochemical and Genetic Perspectives

  2011cites this paper
• Review/ Derleme Evidences for the presence of caspase-like activities in plants

  2011cites this paper
• Senescence and oxidative stress in wallflowers and Arabidopsis

  2011cites this paper
• The vacuolar processing enzyme (VPE) mutation suppresses an HR-like cell death induced by the double knockout mutant of vacuolar Ca 2+ -ATPases in Arabidopsis

  2011cites this paper
• What can plant autophagy do for an innate immune response?

  2011cites this paper
• The Cladosporium fulvum Avr2 protein behaves both as a virulence and an avirulence factor

  2010cites this paper