Coordinated changes of histone modifications and HDAC mobilization regulate the induction of MHC class II genes by Trichostatin A

The deacetylase inhibitor Trichostatin A (TSA) induces the transcription of the Major Histocompatibility Class II (MHC II) DRA gene in a way independent of the master coactivator CIITA. To analyze the molecular mechanisms by which this epigenetic regulator stimulates MHC II expression, we used chromatin immunoprecipitation (ChIP) assays to monitor the alterations in histone modifications that correlate with DRA transcription after TSA treatment. We found that a dramatic increase in promoter linked histone acetylation is followed by an increase in Histone H3 lysine 4 methylation and a decrease of lysine 9 methylation. Fluorescence recovery after photobleaching (FRAP) experiments showed that TSA increases the mobility of HDAC while decreasing the mobility of the class II enhanceosome factor RFX5. These data, in combination with ChIP experiments, indicate that the TSA-mediated induction of DRA transcription involves HDAC relocation and enhanceosome stabilization. In order to gain a genome-wide view of the genes responding to inhibition of deacetylases, we compared the transcriptome of B cells before and after TSA treatment using Affymetrix microarrays. This analysis showed that in addition to the DRA gene, the entire MHC II family and the adjacent histone cluster that are located in chromosome 6p21-22 locus are strongly induced by TSA. A complex pattern of gene reprogramming by TSA involves immune recognition, antiviral, apoptotic and inflammatory pathways and extends the rationale for using Histone Deacetylase Inhibitors (HDACi) to modulate the immune response.

• Publication year

  2006

• Venue

  Nucleic Acids Research

• Publication date

  2006-02-01

• Fields of study

  Biology, Medicine

• Identifiers
  DOI 10.1093/nar/gkj462PMID 16452299PMCID 1360741
• External record

  Open on Semantic Scholar

• Source metadata

  Semantic Scholar, PubMed

• TSA strongly induces the MHC class II gene family and the adjacent histone cluster in B cells.

  Confidence 0.92

  박진우 (dztg5apj7m) extractionB (s683577b42) reviewAnonymous (n259mg7uxy) review
• TSA increases HDAC mobility while reducing RFX5 mobility, supporting HDAC relocation and enhanceosome stabilization at the DRA locus.

  Confidence 0.94

  박진우 (dztg5apj7m) extractionB (s683577b42) reviewAnonymous (n259mg7uxy) review
• TSA induces DRA transcription with increased promoter-linked histone acetylation, followed by increased Histone H3 lysine 4 methylation and decreased lysine 9 methylation.

  Confidence 0.97

  박진우 (dztg5apj7m) extractionB (s683577b42) reviewAnonymous (n259mg7uxy) review

• b cells

  cell type

  The lymphocyte population used for transcriptome comparison before and after TSA treatment.

  Aliases: B cell

  박진우 (dztg5apj7m) extractionB (s683577b42) reviewAnonymous (n259mg7uxy) review
• dra gene

  gene

  The major histocompatibility complex class II DRA locus examined for transcriptional regulation.

  Aliases: HLA-DRA, MHC II DRA gene

  박진우 (dztg5apj7m) extractionB (s683577b42) reviewAnonymous (n259mg7uxy) review
• hdac mobilization

  protein dynamics

  The change in histone deacetylase mobility and relocation measured by FRAP after TSA treatment.

  Aliases: HDAC relocation

  박진우 (dztg5apj7m) extractionB (s683577b42) reviewAnonymous (n259mg7uxy) review
• histone acetylation

  epigenetic mark

  Acetylation of histone proteins at promoter-linked chromatin measured by ChIP in this study.

  Aliases: promoter-linked histone acetylation

  박진우 (dztg5apj7m) extractionB (s683577b42) reviewAnonymous (n259mg7uxy) review
• histone cluster

  gene cluster

  A neighboring cluster of histone genes at the chromosome 6p21-22 locus examined in the transcriptome analysis.

  Aliases: adjacent histone cluster

  박진우 (dztg5apj7m) extractionB (s683577b42) reviewAnonymous (n259mg7uxy) review
• histone h3 lysine 4 methylation

  epigenetic mark

  Methylation of histone H3 at lysine 4 assessed as a chromatin state associated with the DRA promoter.

  Aliases: H3K4 methylation, H3 lysine 4 methylation

  박진우 (dztg5apj7m) extractionB (s683577b42) reviewAnonymous (n259mg7uxy) review
• lysine 9 methylation

  epigenetic mark

  Methylation of histone lysine 9 monitored as a chromatin modification at the DRA promoter.

  Aliases: H3K9 methylation, H3 lysine 9 methylation

  박진우 (dztg5apj7m) extractionB (s683577b42) reviewAnonymous (n259mg7uxy) review
• mhc class ii genes

  gene family

  The set of major histocompatibility complex class II genes whose expression was profiled after TSA treatment.

  Aliases: MHC II genes, class II genes

  박진우 (dztg5apj7m) extractionB (s683577b42) reviewAnonymous (n259mg7uxy) review
• rfx5

  protein

  A class II enhanceosome factor whose mobility was measured by FRAP in response to TSA.

  박진우 (dztg5apj7m) extractionB (s683577b42) reviewAnonymous (n259mg7uxy) review
• trichostatin a

  compound

  A histone deacetylase inhibitor used to perturb chromatin regulation in the experiments.

  Aliases: TSA

  박진우 (dztg5apj7m) extractionB (s683577b42) reviewAnonymous (n259mg7uxy) review

• Histone deacetylase inhibitors.

  2005cited by this paper
• Tumor HLA‐DR expression linked to early intrahepatic recurrence of hepatocellular carcinoma

  2005cited by this paper
• Epigenetic control of MHC-II: interplay between CIITA and histone-modifying enzymes.

  2005cited by this paper
• Histone acetylation regulates the cell type specific CIITA promoters, MHC class II expression and antigen presentation in tumor cells.

  2005cited by this paper
• Relationship between Histone H3 Lysine 9 Methylation, Transcription Repression, and Heterochromatin Protein 1 Recruitment

  2005cited by this paper
• Melanoma cell lines are susceptible to histone deacetylase inhibitor TSA provoked cell cycle arrest and apoptosis.

  2005cited by this paper
• Multiple interactions between BRG1 and MHC class II promoter binding proteins.

  2005cited by this paper
• An epigenetically altered tumor cell vaccine

  2004cited by this paper
• Activation of the Growth-Differentiation Factor 11 Gene by the Histone Deacetylase (HDAC) Inhibitor Trichostatin A and Repression by HDAC3

  2004cited by this paper
• Cell Growth Inhibition and Gene Expression Induced by the Histone Deacetylase Inhibitor, Trichostatin A, on Human Hepatoma Cells

  2004cited by this paper
• Loss of MHC class II gene and protein expression in diffuse large B-cell lymphoma is related to decreased tumor immunosurveillance and poor patient survival regardless of other prognostic factors: a follow-up study from the Leukemia and Lymphoma Molecular Profiling Project.

  2004cited by this paper
• Distinct localization of histone H3 acetylation and H3-K4 methylation to the transcription start sites in the human genome.

  2004cited by this paper
• Signaling to NF-kappaB.

  2004cited by this paper
• Characterization of the expressed CIITA allele in the class II MHC transcriptional mutant RJ2.2.5

  2004influential reference
• Turning tumor cells in situ into T-helper cell-stimulating, MHC class II tumor epitope-presenters: immuno-curing and immuno-consolidation.

  2004cited by this paper
• The chemokine system in diverse forms of macrophage activation and polarization.

  2004cited by this paper
• Histone deacetylase inhibitors.

  2004cited by this paper
• Transcriptional regulation of antigen presentation.

  2004cited by this paper
• Mini‐review: Specificity and expression of CIITA, the master regulator of MHC class II genes

  2004cited by this paper
• Gene expression profiling after treatment with the histone deacetylase inhibitor trichostatin A reveals altered expression of both pro- and anti-apoptotic genes in pancreatic adenocarcinoma cells.

  2004cited by this paper
• Histone deacetylase inhibition improves dendritic cell differentiation of leukemic blasts with AML1‐containing fusion proteins

  2004cited by this paper
• Histone Deacetylase 1/mSin3A Disrupts Gamma Interferon-Induced CIITA Function and Major Histocompatibility Complex Class II Enhanceosome Formation

  2003cited by this paper
• Analysis of Myc bound loci identified by CpG island arrays shows that Max is essential for Myc-dependent repression.

  2003cited by this paper
• Partitioning and plasticity of repressive histone methylation states in mammalian chromatin.

  2003cited by this paper
• Steroid receptor coactivator 1 links the steroid and interferon gamma response pathways.

  2003cited by this paper
• Comparison of the transcriptional regulation of classical and non‐classical MHC class II genes

  2003cited by this paper
• Tumor rejection by gene transfer of the MHC class II transactivator in murine mammary adenocarcinoma cells

  2003cited by this paper
• The signaling adaptors and pathways activated by TNF superfamily.

  2003cited by this paper
• B large-cell lymphoma in children and adolescents.

  2003cited by this paper
• Histone and chromatin cross-talk.

  2003cited by this paper
• Histone methyltransferases direct different degrees of methylation to define distinct chromatin domains.

  2003cited by this paper
• CIITA regulates transcription onset via Ser5‐phosphorylation of RNA Pol II

  2003cited by this paper
• Steroid Receptor Coactivator 1 Links the Steroid and Interferon γ Response Pathways

  2003cited by this paper
• Activation of terminal B cell differentiation by inhibition of histone deacetylation.

  2003cited by this paper
• Gene expression profiling of multiple histone deacetylase (HDAC) inhibitors: defining a common gene set produced by HDAC inhibition in T24 and MDA carcinoma cell lines.

  2003cited by this paper
• Histone acetylation-mediated regulation of genes in leukaemic cells.

  2003cited by this paper
• Modulation of Gene Expression by the MHC Class II Transactivator1

  2002cited by this paper
• Promoter‐specific functions of CIITA and the MHC class II enhanceosome in transcriptional activation

  2002cited by this paper
• The many faces of histone lysine methylation.

  2002cited by this paper
• Characterization of the c-MYC-regulated transcriptome by SAGE: Identification and analysis of c-MYC target genes

  2002cited by this paper
• Genetic control of MHC class II expression.

  2002cited by this paper
• Identifying Genes Regulated in a Myc-dependent Manner*

  2002cited by this paper
• The transcriptional program of a human B cell line in response to Myc.

  2001cited by this paper
• CIITA coordinates multiple histone acetylation modifications at the HLA-DRA promoter

  2001cited by this paper
• Nonclassical MHC class II molecules.

  2000cited by this paper
• Identification of c-myc responsive genes using rat cDNA microarray.

  2000cited by this paper
• Acetylation by PCAF Enhances CIITA Nuclear Accumulation and Transactivation of Major Histocompatibility Complex Class II Genes

  2000cited by this paper
• Activation of MHC Class I, II, and CD40 Gene Expression by Histone Deacetylase Inhibitors1

  2000cited by this paper
• Interactions between the Class II Transactivator and CREB Binding Protein Increase Transcription of Major Histocompatibility Complex Class II Genes

  1999influential reference
• Class II transactivator-independent endothelial cell MHC class II gene activation induced by lymphocyte adhesion.

  1998cited by this paper
• Mice lacking the transcription factor CIITA--a second look.

  1998cited by this paper
• Involvement of CREB Binding Protein in Expression of Major Histocompatibility Complex Class II Genes via Interaction with the Class II Transactivator

  1998influential reference
• Pulmonary lactate release in patients with sepsis and the adult respiratory distress syndrome.

  1996cited by this paper
• Mice lacking the MHC class II transactivator (CIITA) show tissue-specific impairment of MHC class II expression.

  1996cited by this paper

• TIP-20, a novel feline McDonough sarcoma–like tyrosine kinase 3 inhibitor with potent antileukemia activity

  2026cites this paper
• Biological mechanism and immune response of MHC-II expression in tumor cells

  2025cites this paper
• SARS-CoV-2 NSP5 antagonizes MHC II expression by subverting histone deacetylase 2

  2024cites this paper
• Changes in chromatin accessibility and transcriptional landscape induced by HDAC inhibitors in TP53 mutated patient-derived colon cancer organoids.

  2024cites this paper
• Emerging strategies for treating autoimmune disease with genetically modified dendritic cells

  2024cites this paper
• Interferons and Resistance Mechanisms in Tumors and Pathogen-Driven Diseases—Focus on the Major Histocompatibility Complex (MHC) Antigen Processing Pathway

  2023cites this paper
• SARS-COV-2 NSP5 Antagonizes MHC II Expresion by Subverting Histone Deacetylase 2

  2023cites this paper
• Single‐cell profiling‐guided combination therapy of c‐Fos and histone deacetylase inhibitors in diffuse large B‐cell lymphoma

  2022cites this paper
• Moonlighting Proteins Are Important Players in Cancer Immunology

  2021cites this paper
• Cancer cell-intrinsic expression of MHC II in lung cancer cell lines is actively restricted by MEK/ERK signaling and epigenetic mechanisms

  2020cites this paper
• Chapter 7 IFN Inducibility of Major Histocompatibility Antigens in Tumors

  2020influential citation
• Dux-Mediated Corrections of Aberrant H3K9ac during 2-Cell Genome Activation Optimize Efficiency of Somatic Cell Nuclear Transfer.

  2020cites this paper
• Role of the tumor microenvironment on the progression of lung cancer, The

  2019cites this paper
• Posttransplant maintenance therapy in multiple myeloma: the changing landscape

  2017cites this paper
• NF-Y and the immune response: Dissecting the complex regulation of MHC genes.

  2017cites this paper
• Gene activity patterns associated with pathological cardiac hypertrophy are mediated by specific chromatin modifying factors

  2017cites this paper
• Histone Acetylation and the Regulation of Major Histocompatibility Class II Gene Expression.

  2017cites this paper
• Histone deacetylase inhibitors as immunomodulators in cancer therapeutics.

  2016cites this paper
• Plant metabolic clusters - from genetics to genomics.

  2016cites this paper
• Lenalidomide and vorinostat maintenance after autologous transplant in multiple myeloma

  2015cites this paper
• A phase 1 study of vorinostat maintenance after autologous transplant in high-risk lymphoma

  2015cites this paper
• Small molecules that affect the p53 pathway and their potential use in the treatment of cancer

  2014cites this paper
• Epigenetic drugs as immunomodulators for combination therapies in solid tumors.

  2014cites this paper
• GGATAGCACAGCCTGGATAGCAAC TGCGGCAGCATTCTAAGGTT TGCGGATTCTATGAGGCTTCA GATTCAGCAGCTCCACT GATTCAGCAGCTCCACT CAG GAA TAG AGG ATGTGC TCCAGTCACTAGAGCTTG CTCCAGGGTTCTGTAGG CACTGTCCACAAACCTTGCT GAAGTGGCATTCTGTTG CTCCTTCATAATCCTTGATA GGAAGTGCTTGAGGATACGCAC GCAAAGCGAATACTGTGTGCC GGAGACCAAGAATACATTA TTGGCCAI ..

  2013cites this paper
• Aberrant histone modification in peripheral blood B cells from patients with systemic sclerosis.

  2013cites this paper
• Survival factor NFIL3 restricts FOXO-induced gene expression in cancer.

  2013cites this paper
• Incompatible effects of p53 and HDAC inhibition on p21 expression and cell cycle progression

  2013cites this paper
• The role of epigenetic mechanisms and processes in autoimmune disorders

  2012cites this paper
• Regulation of Immune Responses by Histone Deacetylase Inhibitors

  2012cites this paper
• Multiple Histone Methyl and Acetyltransferase Complex Components Bind the HLA-DRA Gene

  2012cites this paper
• Modulation of antigen‐presenting cells by HDAC inhibitors: implications in autoimmunity and cancer

  2012cites this paper
• The E2F1-responsive microRNA-449 promotes apoptosis

  2011cites this paper
• Fragments of genomic DNA released by injured cells activate innate immunity and suppress endocrine function in the thyroid.

  2011cites this paper
• Genome-Wide Histone Acetylation Profiling of Herpesvirus saimiri in Human T Cells upon Induction with a Histone Deacetylase Inhibitor

  2011cites this paper
• Regulation of major histocompatibility complex class II genes.

  2011cites this paper
• Histone deacetylase inhibitors: potential targets responsible for their anti-cancer effect

  2010cites this paper
• Multiple sclerosis etiology: beyond genes and environment

  2010cites this paper
• Coordinate loss of MHC class II expression in the diffuse large B cell lymphoma cell line OCI-Ly2 is due to a novel mutation in RFX-AP

  2010influential citation
• Genetic and epigenetic underpinnings of sex differences in the brain and in neurological and psychiatric disease susceptibility.

  2010cites this paper
• HDAC inhibitors augment cytotoxic activity of rituximab by upregulating CD20 expression on lymphoma cells

  2010cites this paper
• Gamma Interferon-Dependent Transcriptional Memory via Relocalization of a Gene Locus to PML Nuclear Bodies

  2010cites this paper
• Cell surface-bound IL-1α is an upstream regulator of the senescence-associated IL-6/IL-8 cytokine network

  2009cites this paper
• Cytotoxicity Mediated by Histone Deacetylase Inhibitors in Cancer Cells: Mechanisms and Potential Clinical Implications

  2009cites this paper
• The Epigenetic Regulation of Cytokine Inducible Mammalian Transcription by the 26S Proteasome

  2009cites this paper
• E-cadherin regulates metastasis of pancreatic cancer in vivo and is suppressed by a SNAIL/HDAC1/HDAC2 repressor complex.

  2009cites this paper
• The 19S proteasome positively regulates histone methylation at cytokine inducible genes.

  2009cites this paper
• Core promoter acetylation is not required for high transcription from the phosphoenolpyruvate carboxylase promoter in maize

  2009cites this paper
• Induction of Endogenous Interferon Tau Gene Transcription by CDX2 and High Acetylation in Bovine Nontrophoblast Cells1

  2009cites this paper
• Cytotoxicity Mediated by Histone Deacetylase Inhibitors in Cancer Cells: Mechanisms and Potential Clinical Implications

  2009cites this paper
• Multiple sclerosis: major histocompatibility complexity and antigen presentation

  2009cites this paper
• Convergent Random Forest predictor: methodology for predicting drug response from genome-scale data applied to anti-TNF response.

  2009cites this paper
• Histone deacetylase 1, 2, 6 and acetylated histone H4 in B‐ and T‐cell lymphomas

  2009cites this paper
• Rapid histone deacetylation and transient HDAC association in the IL-2 promoter region of TSST-1-stimulated T cells.

  2008cites this paper
• Spatial distribution of histone methylation during MHC class II expression.

  2008influential citation
• Histone deacetylase regulation of immune gene expression in tumor cells

  2008cites this paper
• Synergistic In vivo Antitumor Effect of the Histone Deacetylase Inhibitor MS-275 in Combination with Interleukin 2 in a Murine Model of Renal Cell Carcinoma

  2007cites this paper
• GTP-dependent Recruitment of CIITA to the Class II Major Histocompatibility Complex Promoter*

  2007cites this paper
• Chromium Cross-Links Histone Deacetylase 1-DNA Methyltransferase 1 Complexes to Chromatin, Inhibiting Histone-Remodeling Marks Critical for Transcriptional Activation

  2007cites this paper
• Dynamics and interactions of nuclear proteins revealed by quantitative photobleaching microscopy

  2007cites this paper
• Epigenetic drugs as pleiotropic agents in cancer treatment: Biomolecular aspects and clinical applications

  2007cites this paper
• Inhibition of histone deacetylation promotes abnormal epidermal differentiation and specifically suppresses the expression of the late differentiation marker profilaggrin.

  2007cites this paper
• Epigenetics: relations to disease and laboratory findings.

  2007cites this paper
• Butyrate mediates decrease of histone acetylation centered on transcription start sites and down-regulation of associated genes.

  2007cites this paper
• Regional copy number–independent deregulation of transcription in cancer

  2006cites this paper
• Epigenetic regulation of immune escape genes in cancer

  2006cites this paper
• Epigenetic regulation of MHC-II and CIITA genes.

  2006cites this paper
• Different molecular pathways determining extrahepatic and intrahepatic recurrences of hepatocellular carcinoma.

  2006cites this paper