Microsurgical removal of centrosomes blocks cell reproduction and centriole generation in BSC-1 cells.

No abstract is available for this paper.

• Publication year

  1991

• Venue

  Cell

• Publication date

  1991-11-01

• Fields of study

  Biology, Medicine

• Identifiers
  DOI 10.1016/0092-8674(91)90524-3PMID 1934057
• External record

  Open on Semantic Scholar

• Source metadata

  Semantic Scholar, PubMed

• No claims are published for this paper.

• No concepts are published for this paper.

• Molecular studies of linkage group XIX of Chlamydomonas reinhardtii: evidence against a basal body location

  1991cited by this paper
• Taxol-induced microtubule asters in mitotic extracts of Xenopus eggs: requirement for phosphorylated factors and cytoplasmic dynein

  1991cited by this paper
• A role for the p34cdc2 kinase and phosphatases in the regulation of phosphorylation and disassembly of lamin B2 during the cell cycle.

  1991cited by this paper
• A complex containing p34cdc2 and cyclin B phosphorylates the nuclear lamin and disassembles nuclei of clam oocytes in vitro

  1991cited by this paper
• Universal control mechanism regulating onset of M-phase

  1990cited by this paper
• Tubulovesicular processes emerge from trans-Golgi cisternae, extend along microtubules, and interlink adjacent trans-golgi elements into a reticulum.

  1990cited by this paper
• Driving the cell cycle: M phase kinase, its partners, and substrates

  1990cited by this paper
• Microinjection of p34cdc2 kinase induces marked changes in cell shape, cytoskeletal organization, and chromatin structure in mammalian fibroblasts.

  1990cited by this paper
• Experimental Analysis of Centrosome Reproduction in Echinoderm Eggs

  1990cited by this paper
• Role of microtubules in the organisation of the Golgi apparatus.

  1990cited by this paper
• Protein synthesis and the cell cycle: centrosome reproduction in sea urchin eggs is not under translational control

  1990cited by this paper
• Centrosome duplication continues in cycloheximide-treated Xenopus blastulae in the absence of a detectable cell cycle

  1990cited by this paper
• Mode of centriole duplication and distribution

  1990cited by this paper
• The basal bodies of Chlamydomonas reinhardtii do not contain immunologically detectable DNA.

  1990cited by this paper
• Driving the cell cycle: M phase kinase, its partners, and substrates.

  1990cited by this paper
• 225-Kilodalton phosphoprotein associated with mitotic centrosomes in sea urchin eggs.

  1989cited by this paper
• Reproductive capacity of sea urchin centrosomes without centrioles.

  1989cited by this paper
• p34cdc2 is located in both nucleus and cytoplasm; part is centrosomally associated at G2/M and enters vesicles at anaphase.

  1989cited by this paper
• Basal body/centriolar DNA: molecular genetic studies in Chlamydomonas.

  1989cited by this paper
• Nuclear and cytoplasmic mitotic cycles continue in Drosophila embryos in which DNA synthesis is inhibited with aphidicolin

  1988cited by this paper
• Organization of microtubules in centrosome-free cytoplasm

  1988cited by this paper
• Control of microtubule nucleation and stability in Madin-Darby canine kidney cells: the occurrence of noncentrosomal, stable detyrosinated microtubules

  1987cited by this paper
• The centrosome and its role in the organization of microtubules.

  1987cited by this paper
• The chromosome cycle and the centrosome cycle in the mitotic cycle.

  1987cited by this paper
• Release of mature starfish oocytes from interphase arrest by microinjection of human centrosomes

  1987cited by this paper
• Disruption of the Dictyostelium myosin heavy chain gene by homologous recombination.

  1987cited by this paper
• Behavior of centrosomes during fertilization and cell division in mouse oocytes and in sea urchin eggs.

  1986cited by this paper
• Experimental analysis of the reproduction of spindle poles.

  1985cited by this paper
• A vital stain for the Golgi apparatus.

  1985cited by this paper
• Cyclic-AMP-dependent protein kinase type II is associated with the Golgi complex and with centrosomes.

  1985cited by this paper
• Centriole number and the reproductive capacity of spindle poles

  1985cited by this paper
• Non-spindle microtubule organizing centers in metaphase II-arrested mouse oocytes

  1985cited by this paper
• ATP-induced gelation--contraction of microtubules assembled in vitro

  1984cited by this paper
• Role of the centrosome in organizing the interphase microtubule array: properties of cytoplasts containing or lacking centrosomes

  1984cited by this paper
• Phosphoproteins are components of mitotic microtubule organizing centers.

  1984cited by this paper
• Activity and stability of centrosomes in Chinese hamster ovary cells in nucleation of microtubules in vitro.

  1984cited by this paper
• Centrosomes and mitotic poles.

  1984cited by this paper
• Centrosome development in early mouse embryos as defined by an autoantibody against pericentriolar material.

  1983cited by this paper
• The centriole, a central enigma of cell biology

  1982cited by this paper
• Continuous hypertonic conditions activate and promote the formation of new centrioles within cytasters in sea urchin eggs.

  1982cited by this paper
• Structural interaction of cytoskeletal components

  1981cited by this paper
• Centriole cycle in Chinese hamster ovary cells as determined by whole- mount electron microscopy

  1981cited by this paper
• The control of microtubule assembly in vivo.

  1979cited by this paper
• Purification and characterization of regenerating mouse L929 karyoplasts.

  1979cited by this paper
• ORIGIN OF TWONESS IN CELL REPRODUCTION

  1978cited by this paper
• The absence of centrioles from spindle poles of rat kangaroo (PtK2) cells undergoing meiotic-like reduction division in vitro

  1977cited by this paper
• Dependence of centriole formation on protein synthesis

  1976cited by this paper
• Microtubules and Microfilaments

  1974cited by this paper
• BASAL BODIES, BUT NOT CENTRIOLES, IN NAEGLERIA

  1971cited by this paper
• DETERMINATION, DEVELOPMENT, AND INHERITANCE OF THE STRUCTURE OF THE CELL CORTEX*

  1970cited by this paper
• The development of basal bodies in paramecium.

  1968cited by this paper
• THE PRESENCE OF CENTRIOLES IN ARTIFICIALLY ACTIVATED SEA URCHIN EGGS

  1961cited by this paper
• The Multiplicity of the Mitotic Centers and the Time-Course of Their Duplication and Separation

  1960cited by this paper
• Relation between cell growth and cell division. II. The effect of cell size on cell growth rate and generation time in Amoeba proteus.

  1956cited by this paper
• Problems of morphogenesis in ciliates.

  1950cited by this paper
• Die Befruchtung und Teilung des Eies von Ascaris megalocephala

  year unknowncited by this paper

• Aurora A Kinase Begins to Localize to the Centrosome in the S-phase of the Cell Cycle in the XL2 Cell Line.

  2024cites this paper
• Developmental and tissue‐specific roles of mammalian centrosomes

  2024cites this paper
• An updated view on the centrosome as a cell cycle regulator

  2022cites this paper
• Anti-Sitoplazmik ve Anti-Mitotik Otoantikorlar; Bu Antikorların Hastalıklarla İlişkisi Var Mı?

  2022cites this paper
• Reduction, proliferation, and differentiation defects of stem cells over time: a consequence of selective accumulation of old centrioles in the stem cells?

  2022cites this paper
• Cell Cycle, DNA Replication, Centrosomes, Centrioles and Cell Division

  2020cites this paper
• 12 Programming and Implementation of Age-Related Changes

  2017cites this paper
• Centriole continuity: out with the new, in with the old.

  2016cites this paper
• The stabilization of basal bodies to resist cilia generated forces

  2016cites this paper
• High incidence of pulmonary arterial hypertension in systemic sclerosis patients with anti-centriole autoantibodies

  2015cites this paper
• Centrosomes and cancer: revisiting a long-standing relationship

  2015cites this paper
• Centrosome maturation requires YB-1 to regulate dynamic instability of microtubules for nucleus reassembly

  2015cites this paper
• Polo-Like Kinases (Plks), a Key Regulator of Cell Cycle and New Potential Target for Cancer Therapy

  2014cites this paper
• Centrosomes and the art of mitotic spindle maintenance.

  2014cites this paper
• Centrosomes as signalling centres

  2014cites this paper
• Golgi depletion from living cells with laser nanosurgery.

  2013cites this paper
• Loss of centrioles causes chromosomal instability in vertebrate somatic cells

  2013cites this paper
• Centrosome Dysfunction Contributes to Chromosome Instability, Chromoanagenesis, and Genome Reprograming in Cancer

  2013cites this paper
• At the cutting edge: applications and perspectives of laser nanosurgery in cell biology

  2012cites this paper
• Centrosomes, DNA Damage and Aneuploidy

  2012cites this paper
• Programming and Implementation of Age-Related Changes

  2012cites this paper
• γ-Tubulin plays a key role in inactivating APC/CCdh1 at the G1–S boundary

  2012cites this paper
• The Minimal Cell and Life’s Origin: Role of Water and Aqueous Interfaces

  2011cites this paper
• A novel laser nanosurgery approach supports de novo Golgi biogenesis in mammalian cells

  2011cites this paper
• How cellular membranes can regulate microtubule network

  2010cites this paper
• Centrioles: active players or passengers during mitosis?

  2010cites this paper
• Centriole, Differentiation, and Senescence

  2010cites this paper
• Centriole evolution.

  2009cites this paper
• The mitotic spindle mediates inheritance of the Golgi ribbon structure

  2009cites this paper
• Passage through the Golgi is necessary for Shiga toxin B subunit to reach the endoplasmic reticulum

  2009cites this paper
• Molecular Dissection of the Centrosome Overduplication Pathway in S-Phase-Arrested Cells

  2009cites this paper
• The yeast lysosome-like vacuole: endpoint and crossroads.

  2009cites this paper
• The recycling endosome is required for transport of retrograde toxins

  2009cites this paper
• Centriole inheritance

  2008cites this paper
• Spatial organization of centrosome-attached and free microtubules in 3T3 fibroblasts

  2008cites this paper
• Increased expression of Nlp, a potential oncogene in ovarian cancer, and its implication in carcinogenesis.

  2008cites this paper
• Microtubules' interaction with cell cortex is required for their radial organization, but not for centrosome positioning.

  2007cites this paper
• Ultrastructural Localization of the Cytoplasmic Distribution of Gamma Tubulin in Induced Differentiating Human Leukemia Cells

  2007cites this paper
• Identification of Eg5 as a Mind bomb1-associated protein and their roles in centrosome duplication

  2007cites this paper
• Cell cycle progression and de novo centriole assembly after centrosomal removal in untransformed human cells

  2007cites this paper
• What is the function of centrioles?

  2007cites this paper
• Structural characterization and distribution of zebrafish germ plasm during interphase and mitosis

  2007cites this paper
• Dynein and dynactin as organizers of the system of cell microtubules

  2006cites this paper
• The Human Polo-like Kinase 4 is a Regulator of Centrosome Duplication

  2006cites this paper
• Characterization of JNK Binding Proteins: A Dissertation

  2005cites this paper
• Two-way traffic: centrosomes and the cell cycle

  2005cites this paper
• Hypothesis: the origin of life in a hydrogel environment.

  2005cites this paper
• Centriolar Mechanisms of Differentiation and Replicative Aging of Higher Animal Cells

  2005cites this paper
• DNA as classical and quantum information system: Implication to gene expression in normal and cancer cells

  2005cites this paper
• Potential role of centrioles in determining the morphogenetic status of animal somatic cells

  2005cites this paper
• The GIT-associated kinase PAK targets to the centrosome and regulates Aurora-A.

  2005cites this paper
• The centrosome in higher organisms: structure, composition, and duplication.

  2004cites this paper
• Computational model of dynein-dependent self-organization of microtubule asters

  2004cites this paper
• Bld10p, a novel protein essential for basal body assembly in Chlamydomonas

  2004cites this paper
• Spermatozoa of the Loach Misgurnus fossilis in the Identification of New Centrosome Proteins

  2004cites this paper
• Dynamic Behaviour of Microtubule Plus End Binding Proteins in Cultured Cells

  2004cites this paper
• A new theory of the origin of cancer: quantum coherent entanglement, centrioles, mitosis, and differentiation.

  2004cites this paper
• A case of scleroderma spectrum disorder with anticentriole antibody and pulmonary hypertension

  2004cites this paper
• controle de la transition meiose I/meiose II et role de DOC1R au cours de l'arret CSF lors de la maturation meiotique chez la souris

  2004cites this paper
• Polar expeditions — provisioning the centrosome for mitosis

  2003cites this paper
• In Vitro Reconstitution of Centmmm and Function : The Central Rde of y = Tubuiin

  2003cites this paper
• Cell brain: a new focus in the postgenomic era.

  2003cites this paper
• Anomalous centriole configurations are detected in Drosophila wing disc cells upon Cdk1 inactivation

  2003cites this paper
• The role of aqueous interfaces in the cell.

  2003cites this paper
• A kinesin mutant with an atypical bipolar spindle undergoes normal mitosis.

  2003cites this paper
• Self-organization of treadmilling microtubules into a polar array.

  2002cites this paper
• De novo formation of centrosomes in vertebrate cells arrested during S phase

  2002cites this paper
• The cell as a biomaterial

  2002cites this paper
• The ZYG-1 kinase, a mitotic and meiotic regulator of centriole replication

  2002cites this paper
• Arrest of cell cycle progression during first interphase in murine zygotes microinjected with anti-PCM-1 antibodies.

  2002cites this paper
• CENTROSOME‐DEPENDENT ANISOTROPIC RANDOM WALK OF CYTOPLASMIC VESICLES

  2002cites this paper
• Golgi architecture and inheritance.

  2002cites this paper
• GTCGACATCAGGAAGGACCT GAGAGAGCGCGAACGCAGAC TTGGGTATGGAATCCTGTGG GGTGTAAAACGCAGCTCAGT TTGGTGGACAAACTACAGAC TTCTTCGCTTATGACTTTAG CCTGTCCAGCATAGTGGAGC AATCGCATTGGGGTTTGAGC GGCTATGAGCGGACTGAGCT GAGCAAGGCCTGTAGGCGCT GAAGGTGTGGTGCCAGATCTTCTCCATGTCGTCCCA GTCGTCCTGAGGAGAGAGAGCGCGAACGCAGACGCG CCGTTCGATGTTGCGC

  2002cites this paper
• Transferrin receptor recycling in the absence of perinuclear recycling endosomes

  2002cites this paper
• The mechanics of asymmetric spindle positioning in the Caenorhabditis elegans embryo

  2002cites this paper
• Jcb: Article Introduction

  2002cites this paper
• Genetic reprogramming of mammalian skeletal muscle cells by Trichinella spiralis.

  2001cites this paper
• Requirement of a Centrosomal Activity for Cell Cycle Progression Through G1 into S Phase

  2001cites this paper
• Maintenance of Golgi structure and function depends on the integrity of ER export

  2001cites this paper
• Phase transitions and molecular motion in the cell.

  2001cites this paper
• Cell cycle. Centrioles at the checkpoint.

  2001cites this paper
• The Contribution of Epigenetic Changes to Abnormal Centrosomes and Genomic Instability in Breast Cancer

  2001cites this paper
• Centrosome-Dependent Exit of Cytokinesis in Animal Cells

  2001cites this paper
• "It takes two to tango": understanding how centrosome duplication is regulated throughout the cell cycle.

  2001cites this paper
• Centrosome abnormalities, genomic instability and carcinogenic progression.

  2001cites this paper
• Is the cell a gel--and why does it matter?

  2001cites this paper
• In vitro approaches for the study of molecular motors in aster formation.

  2001cites this paper
• Centrioles take center stage.

  2001cites this paper
• Kendrin/pericentrin-B, a centrosome protein with homology to pericentrin that complexes with PCM-1.

  2001cites this paper
• Kinetics and regulation of de novo centriole assembly. Implications for the mechanism of centriole duplication.

  2001cites this paper
• Centrosomes as command centres for cellular control

  2001cites this paper
• The centrosome in vertebrates: more than a microtubule-organizing center.

  2001cites this paper
• Centrosomes Enhance the Fidelity of Cytokinesis in Vertebrates and Are Required for Cell Cycle Progression

  2001cites this paper
• Mutation of a Drosophila gamma tubulin ring complex subunit encoded by discs degenerate-4 differentially disrupts centrosomal protein localization.

  2000cites this paper
• Dinoflagellate centrosome: Associated proteins old and new

  2000cites this paper
• Identification and characterization of Caenorhabditis elegans gamma-tubulin in dividing cells and differentiated tissues.

  2000cites this paper
• Basal bodies and centrioles: their function and structure.

  2000cites this paper
• Centrosome-independent mitotic spindle formation in vertebrates.

  2000cites this paper
• The centrosome and parthenogenesis.

  2000cites this paper
• GFP‐centrin as a marker for centriole dynamics in living cells

  2000cites this paper