CYP1A1 and GSTM1 genetic polymorphisms and lung cancer risk in Caucasian non-smokers: a pooled analysis.

No abstract is available for this paper.

• Publication year

  2003

• Venue

  Carcinogenesis

• Publication date

  2003-05-01

• Fields of study

  Biology, Medicine

• Identifiers
  DOI 10.1093/CARCIN/BGG026PMID 12771031
• External record

  Open on Semantic Scholar

• Source metadata

  Semantic Scholar, PubMed

• No claims are published for this paper.

• No concepts are published for this paper.

• Meta- and pooled analyses of the effects of glutathione S-transferase M1 polymorphisms and smoking on lung cancer risk.

  2002cited by this paper
• Human cytochrome P-450 (CYP) genes: a web page for the nomenclature of alleles.

  2001cited by this paper
• Residential Radon and Lung Cancer among Never-Smokers in Sweden

  2001cited by this paper
• Polymorphisms of the CYP1A1 and GSTM1 genes in relation to individual susceptibility to lung carcinoma in Chinese population.

  2001cited by this paper
• Differential metabolism of benzo[a]pyrene and benzo[a]pyrene-7,8-dihydrodiol by human CYP1A1 variants.

  2001cited by this paper
• Globocan 2000 : cancer incidence, mortality and prevalence worldwide

  2001cited by this paper
• Metabolic gene allele nomenclature.

  2001cited by this paper
• Gender differences in genetic susceptibility for lung cancer.

  2000cited by this paper
• Population stratification in epidemiologic studies of common genetic variants and cancer: quantification of bias.

  2000cited by this paper
• Genetic polymorphism of CYP genes, alone or in combination, as a risk modifier of tobacco-related cancers.

  2000cited by this paper
• Glutathione S-transferase M1 polymorphism and lung cancer risk in African-Americans.

  2000cited by this paper
• Lung cancer risk in nonsmokers and GSTM1 and GSTT1 genetic polymorphism.

  2000cited by this paper
• CYP1A1 polymorphisms and lung cancer risk: a meta-analysis.

  2000cited by this paper
• Relation between inducibility of CYP1A1, GSTM1 and lung cancer in a French population.

  2000cited by this paper
• GSTM1, GSTP1, CYP1A1 and CYP2D6 polymorphisms in lung cancer patients from an environmentally polluted region of Poland: correlation with lung DNA adduct levels.

  1999cited by this paper
• Review of studies of selected metabolic polymorphisms and cancer.

  1999cited by this paper
• International collaborative study on genetic susceptibility to environmental carcinogens.

  1999cited by this paper
• Metabolic Polymorphisms and Susceptibility to Cancer

  1999cited by this paper
• The glutathione S-transferases: influence of polymorphism on cancer susceptibility.

  1999cited by this paper
• Concise review of the glutathione S-transferases and their significance to toxicology.

  1999cited by this paper
• A European validation study of smoking and environmental tobacco smoke exposure in nonsmoking lung cancer cases and controls

  1998cited by this paper
• Genetic polymorphism of glutathione S-transferases M1 and T1 as a risk factor in lung and bladder cancers.

  1998cited by this paper
• CYP2D6 phenotype-genotype relationships in African-Americans and Caucasians in Los Angeles.

  1998cited by this paper
• Smoking-associated bulky DNA adducts in bronchial tissue related to CYP1A1 MspI and GSTM1 genotypes in lung patients.

  1998cited by this paper
• Lung cancer risk and CYP1A1 genotype in African Americans.

  1998cited by this paper
• Epidemiology and prevention of lung cancer in nonsmokers.

  1998cited by this paper
• Combined effect of polymorphic GST genes on individual susceptibility to lung cancer

  1998cited by this paper
• Associations of CYP1A1, GSTM1, and CYP2E1 polymorphisms with lung cancer suggest cell type specificities to tobacco carcinogens.

  1998cited by this paper
• Biomarkers: Medical and Workplace Applications

  1998cited by this paper
• Bias in meta›analysis detected by a simple, graphical test

  1998cited by this paper
• Bias in meta-analysis detected by a simple, graphical test

  1997cited by this paper
• Genotypes of glutathione transferase M1 and P1 and their significance for lung DNA adduct levels and cancer risk.

  1997cited by this paper
• In vitro kinetics of two human CYP1A1 variant enzymes suggested to be associated with interindividual differences in cancer susceptibility.

  1997cited by this paper
• The Relationship between Aryl Hydrocarbon Hydroxylase and Polymorphisms of the CYP1A1 Gene

  1996cited by this paper
• Lung cancer risk in relation to the CYP2E1 Rsa I genetic polymorphism among African-Americans and Caucasians in Los Angeles County.

  1996cited by this paper
• A C4887A polymorphism in exon 7 of human CYP1A1: population frequency, mutation linkages, and impact on lung cancer susceptibility.

  1996cited by this paper
• Characterization of purified human recombinant cytochrome P4501A1-Ile462 and -Val462: assessment of a role for the rare allele in carcinogenesis.

  1996cited by this paper
• Exposure to urban and rural air pollution: DNA and protein adducts and effect of glutathione-S-transferase genotype on adduct levels

  1996cited by this paper
• Risk of smoking for squamous and small cell carcinomas of the lung modulated by combinations of CYP1A1 and GSTM1 gene polymorphisms in a Japanese population.

  1995cited by this paper
• Genetic-environmental interactions and low-level exposure to carcinogens.

  1995cited by this paper
• Functional significance of different human CYP1A1 genotypes.

  1994cited by this paper
• Combined effect of CYP1A1 inducibility and GSTM1 polymorphism on histological type of lung cancer.

  1994cited by this paper
• Genetic susceptibility to lung cancer with special emphasis on CYP1A1 and GSTM1: a study on host factors in relation to age at onset, gender and histological cancer types.

  1994cited by this paper
• Association between CYP1A1 genotype, mRNA expression and enzymatic activity in humans.

  1994cited by this paper
• Genetically based N-acetyltransferase metabolic polymorphism and low-level environmental exposure to carcinogens

  1994cited by this paper
• Genotype and phenotype of glutathione S-transferase class mu isoenzymes mu and psi in lung cancer patients and controls.

  1993cited by this paper
• The CYP1A1 gene and cancer susceptibility.

  1993cited by this paper
• Occupational risk factors for lung cancer among nonsmoking women: a case-control study in Missouri (United States)

  1993cited by this paper
• Relationship between genotype and function of the human CYP1A1 gene.

  1993cited by this paper
• Genotype and Phenotype of Glutathione S-Transferase Class µ Isoenzymes µ and ψ in Lung Cancer Patients and Controls

  1993cited by this paper
• Mutant genes of cytochrome P-450IID6, glutathione S-transferase class Mu, and arylamine N-acetyltransferase in lung cancer patients

  1992cited by this paper
• Point-mutational MspI and Ile-Val polymorphisms closely linked in the CYP1A1 gene: lack of association with susceptibility to lung cancer in a Finnish study population.

  1992cited by this paper
• Human CYP1A1 (cytochrome P(1)450) gene: lack of association between the Msp I restriction fragment length polymorphism and incidence of lung cancer in a Norwegian population.

  1991cited by this paper
• Protective dietary factors and lung cancer.

  1990cited by this paper
• Identification of genetically high risk individuals to lung cancer by DNA polymorphisms of the cytochrome P45 0IA1 gene

  1990cited by this paper
• Meta-analysis in clinical trials.

  1986cited by this paper
• IARC Monographs on the Evaluation of the Carcinogenic Risk of Chemicals to Humans

  1980cited by this paper

• Lung Cancers in Never-Smokers: A Different Disease?

  2025cites this paper
• Environmental Microbiology and Biotechnology: Volume 2: Bioenergy and Environmental Health

  2021influential citation
• Individual and combined effects of GSTM1, GSTT1, and GSTP1 polymorphisms on lung cancer risk

  2021influential citation
• Modi cation of DNMTs Gene Expressions by GST O1 and GST O2 Polymorphism in Chronic Arsenic Exposed People with and without malignancy from West Bengal, India

  2021cites this paper
• Independent and Interactive Effect of CYPs and GSTs Genetic Variants and Tobacco Smoking on the Risk of Non-Small Cell Lung Carcinoma.

  2021cites this paper
• Relationship Between Variants of Detoxification Genes and 3-hydroxybenzo[a]pyrene Concentration in Urine of Coke Plant Workers

  2020cites this paper
• Relevance of genetic polymorphisms in tobacco-related detoxifying enzymes in non-small cell lung carcinoma susceptibility

  2020cites this paper
• Evaluation of Blood Lipid Concentrations of Dioxins in Firefighters Depending on Polymorphic Variants of Xenobiotic Detoxification Genes

  2020cites this paper
• Influence of xenobiotic detoxication gene polymorphisms and experience on the level of accumulation of dioxins in Emercom of Russia employees

  2020cites this paper
• Interactions of Environmental Risk Factors and Genetic Variations: Association with Susceptibility to Cancer

  2020cites this paper
• Edentulousness in severely mentally ill patients: A pilot study of sex-specific patterns for risk factors including the glutathione S-transferase M1 gene.

  2020cites this paper
• Влияние полиморфизмов генов детоксикации ксенобиотиков и стажа работы на уровень кумуляции диоксинов в организме сотрудников МЧС России

  2020cites this paper
• Familial cancer risk in family members and spouses of patients with early‐onset head and neck cancer

  2020cites this paper
• Characterization of metabolic activity, isozyme contribution and species differences of bavachin, and identification of efflux transporters for bavachin‐O‐glucuronide in HeLa1A1 cells

  2020cites this paper
• Lung Cancer: Genetic Susceptibility

  2020cites this paper
• Chronic obstructive pulmonary disease (COPD) and lung cancer: common pathways for pathogenesis.

  2019cites this paper
• Behavioral Health Service Utilization Among Detained Adolescents: A Meta-Analysis of Prevalence and Potential Moderators.

  2019cites this paper
• Gender-Related Differences in Lung Cancer

  2018cites this paper
• Genotoxicity and Cytotoxicity Evaluation Applied to Environmental Health, Research of Polycyclic Aromatic Hydrocarbons

  2018cites this paper
• Autochthonous murine models for the study of smoker and never-smoker associated lung cancers.

  2018cites this paper
• Facteurs de risque des cancers bronchiques : tabac, exposition professionnelle et environnementale

  2018cites this paper
• Green Tobacco Sickness among Brazilian farm workers and genetic polymorphisms

  2018cites this paper
• Genetic polymorphisms of CYP 1 A 1 , GSTM 1 and GSTT 1 genes and lung cancer risk

  2017cites this paper
• Interaction between air pollution and host factors in lung cancer

  2017cites this paper
• State of Art of Cancer Pharmacogenomics in Latin American Populations

  2017cites this paper
• Association between the Polymorphism of Glutathione S-transferase Genes and Autoimmune Diseases in Asian Population: a Meta-analysis

  2017cites this paper
• Association of CYP3A5*3 and CYP1A1*2C Polymorphism with Development of Acute Myeloid Leukemia in Egyptian Patients

  2017cites this paper
• GENETIC POLYMORPHISMS AND THE RISK OF LUNG CANCER IN TUNNEL WORKERS IN RIO DE JANEIRO, BRAZIL

  2017cites this paper
• The interaction between smoking and CYP1A1 MspI polymorphism on lung cancer: a meta‐analysis in the Chinese population

  2017cites this paper
• Genetic polymorphisms of human cytochrome P450 CYP1A1 in an Egyptian population and tobacco-induced lung cancer

  2017influential citation
• Lung Adenocarcinoma in Never Smokers: Problems of Primary Prevention from Aspects of Susceptible Genes and Carcinogens.

  2016cites this paper
• Frequency Evaluation of T6235C (m1) and A4889G (m2) Polymorphisms of CYP1A1 Gene in a Healthy Population from the west of Mazandaran Province, Iran.

  2016cites this paper
• Synergistic Association of CYP1A1 Polymorphisms with Increased Susceptibility to Squamous Cell Lung Cancer in North Indian Smokers

  2016cites this paper
• Антитела против бензо[а]пирена и полиморфизм CYP1A1*2a, CYP1A2*1f, GSTT1, GSTM1 у здоровых мужчин и больных раком легкого

  2016cites this paper
• Gene mutation discovery research of non-smoking lung cancer patients due to indoor radon exposure

  2016cites this paper
• The ILE462VAL polymorphism of the cytochrome P450 CYP1A1 gene in the Tundra Nenets of the Yamalo-Nenets Autonomous Okrug, Nganasans of the Taimyr Peninsula, and Russians of Siberia

  2016cites this paper
• Epistasis Test in Meta-Analysis: A Multi-Parameter Markov Chain Monte Carlo Model for Consistency of Evidence

  2016cites this paper
• Identification of gene markers in the development of smoking-induced lung cancer.

  2016cites this paper
• Risk Factors for Lung Cancer in Never Smokers: A Recent Review Including Genetics

  2016cites this paper
• Association of CYP1A1, GSTM1 and GSTT1 gene polymorphisms with risk of non-small cell lung cancer in Andhra Pradesh region of South India

  2016cites this paper
• Lung Cancer Incidence Trends in Iran and in Six Geographical Regions of the Country (2000 - 2005)

  2016cites this paper
• The Clinical Relevance of the miR-197/CKS1B/STAT3-mediated PD-L1 Network in Chemoresistant Non-small-cell Lung Cancer

  2015cites this paper
• The Role of Genotypes That Modify the Toxicity of Chemical Mutagens in the Risk for Myeloproliferative Neoplasms

  2015cites this paper
• Fetal Epigenetic Origins of Disease

  2015cites this paper
• CYP1A1 MspI polymorphism and susceptibility to lung cancer in the Chinese population: an updated meta-analysis and review.

  2015cites this paper
• Cytochrome P450 1A1 genetic polymorphisms as cancer biomarkers.

  2015cites this paper
• Genetic polymorphisms of CYP1A1 and risk of leukemia: a meta-analysis

  2015cites this paper
• Functional Analysis of Novel Prognostic Markers of Non-small Cell Lung Cancer

  2014cites this paper
• Association between glutathione S-transferase T1 null genotype and risk of lung cancer: a meta-analysis of 55 studies

  2014cites this paper
• Polymorphism of CYP1A1 gene and susceptibility to childhood acute lymphoblastic leukemia in Egypt

  2014cites this paper
• Combined effects of CYP1A1 MspI and GSTM1 genetic polymorphisms on risk of lung cancer: an updated meta-analysis

  2014cites this paper
• Meta-and pooled analysis of GSTM 1 and CYP 1 A 1 polymorphisms and oropharyngeal cancer : a HuGE-GSEC review

  2014cites this paper
• Environmental Etiology of Polycythemia Vera, Essential Thrombocythemia and Primary Myelofibrosis: A Case-Control Study in Northeast Pennsylvania

  2014cites this paper
• Association of CYP1A1 gene variants rs4646903 (T>C) and rs1048943 (A>G) with cervical cancer in a North Indian population.

  2014cites this paper
• [Single nucleotide polymorphisms in lung cancer patients and cisplatin treatment].

  2014cites this paper
• Lung cancer in never smokers: disease characteristics and risk factors.

  2013cites this paper
• Genetic susceptibility to lung cancer--light at the end of the tunnel?

  2013cites this paper
• Molecular profile of lung cancer in never smokers

  2013cites this paper
• Polymorphisms of genes involved in polycyclic aromatic hydrocarbons’ biotransformation and atherosclerosis

  2013cites this paper
• Recherche d’une éventuelle association entre les polymorphismes génétiques cytochrome P4501A1*2C, glutathion-S-transférase M1 null et le cancer du poumon chez une population Tunisienne

  2013cites this paper
• Potentially estrogenic polychlorinated biphenyls congeners serum levels and its relation with lung cancer

  2013cites this paper
• EGFR polymorphisms, hormone replacement therapy and lung adenocarcinoma risk: analysis from a genome-wide association study in never-smoking women.

  2013cites this paper
• Glutathione S-transferase and Catalase gene polymorphisms with Type 2 diabetes mellitus. -

  2013cites this paper
• Association of gene polymorphism in detoxification enzymes and urinary 8-OHdG levels in traffic policemen exposed to vehicular exhaust

  2013cites this paper
• Epidemiology of Lung Cancer in Women

  2013cites this paper
• Quantitation of the metabolic activation of phenanthrene in smokers:potential use in the assessment of lung cancer susceptibility

  2012cites this paper
• Lung cancer in never smokers--a review.

  2012cites this paper
• Role of CYP1A1 MspI polymorphism in CYP1A1 gene with susceptibility to lung cancer in Iranian patients

  2012cites this paper
• Role of CYP 1 A 1 Msp I polymorphism in CYP 1 A 1 gene with susceptibility to lung cancer in Iranian patients

  2012cites this paper
• Correlation of CYP1A1, GSTP1 and GSTM1 gene polymorphisms and lung cancer risk among smokers.

  2012cites this paper
• Rapid identification of CYP2C8 polymorphisms by high resolution melting analysis.

  2012cites this paper
• Impact of Glutathione Transferase M1, T1, and P1 Gene Polymorphisms in the Genetic Susceptibility of North Indian Population to Renal Cell Carcinoma

  2012cites this paper
• Nutrigenomics

  2012cites this paper
• The effect of CYP1A1, GSTT1 and GSTM1 polymorphisms on the risk of lung cancer

  2012cites this paper
• Lung Cancer in a Male Smoker Treated by Adjunct Nutritional and Phyto-Therapy

  2012cites this paper
• Lung adenocarcinoma and squamous cell carcinoma in association with genetic polymorphisms of GSTs in Slovak population.

  2012cites this paper
• DOHÁNYZÁS EREDETŰ DNS KÁROSODÁSOK ÖSSZEFÜGGÉSEINEK VIZSGÁLATA BIOMARKEREKKEL HUMÁN TÜDŐDAGANATOS POPULÁCIÓBAN

  2012cites this paper
• Genetic Susceptibility to Lung Cancer

  2012cites this paper
• Molecular Epidemiology of Female Lung Cancer

  2011cites this paper
• Polymorphisms associated with the risk of lung cancer in a healthy Mexican Mestizo population: Application of the additive model for cancer

  2011influential citation
• Glutathione S-transferase and CYP1A1 gene polymorphisms and non-melanoma skin cancer risk in Italian transplanted patients.

  2011cites this paper
• Characterization of FOXO3a as a suppressor of lung adenocarcinoma

  2011cites this paper
• CYP1A1和GSTM1基因多态性及其对个体肺癌易感性的联合效应：meta分析

  2011cites this paper
• Lung cancer in never smokers.

  2011cites this paper
• Metabolism of [D10]Phenanthrene to Tetraols in Smokers for Potential Lung Cancer Susceptibility Assessment: Comparison of Oral and Inhalation Routes of Administration

  2011cites this paper
• Never smokers with lung cancer: analysis of genetic variants.

  2011cites this paper
• Glutathione S- transferase M1 and T1 gene polymorphisms in South Indian stroke patients

  2011cites this paper
• La glutathion S-transferasa M1, el citocromo P450 1A1 y la epóxido hidrolasa como biomarcadores epidemiológicos de susceptibilidad genética de los cánceres de orofaringe

  2011influential citation
• Genotoxic effects of the combined influence of radon and heavy metals depending on polymorphism of genes of monooxygenase system enzymes

  2011cites this paper
• CTCAGAAA GGAGGGAGCTTCCTTCTCCT GCTGTCTT CCTTTGCAATTGGCTGGAG AGCGACTTA CCTCACCCCAGTTACCAAAG CTCCCAGT TGAAGACAGGTAACTGTTAAGGTCA AACAAATGCAAA AACGGAGCAGATCACATTGC TGATCCCA ATCCTGAAGTTTTCATTGAATC GAAACGAT CAAGTCTTCCCTACAACCTTGA CTTGGTGT TCACAAAATGGACAAGAAATCAA TATACTGGCA TCAGCATTGTTCTGAAATTCACT ATCTTCGTT

  2011cites this paper
• CYP1A1*2A polymorphism as a predictor of clinical outcome in advanced lung cancer patients treated with EGFR-TKI and its combined effects with EGFR intron 1 (CA)n polymorphism.

  2011cites this paper
• Environmental Epidemiology and Human Health: Biomarkers of Disease and Genetic Susceptibility

  2011cites this paper
• Analysis of r-7,t-8,9,c-10-tetrahydroxy-7,8,9,10-tetrahydrobenzo[a]pyrene in human urine: a biomarker for directly assessing carcinogenic polycyclic aromatic hydrocarbon exposure plus metabolic activation.

  2011cites this paper
• Quantitation of a minor enantiomer of phenanthrene tetraol in human urine: correlations with levels of overall phenanthrene tetraol, benzo[a]pyrene tetraol, and 1-hydroxypyrene.

  2011cites this paper
• Lung cancer in never smokers: change of a mindset in the molecular era.

  2011cites this paper
• Maternal smoking during pregnancy, polymorphic CYP1A1 and GSTM1, and lung-function measures in urban family children.

  2011cites this paper
• Association of GSTT1, GSTM1 and CYP1A1 polymorphisms with susceptibility to systemic lupus erythematosus in the Chinese population.

  2010cites this paper
• Gene–Environment Interactions, Phenotypic Changes, and Human Health

  2010cites this paper
• CYP1A1, GSTM1 and GSTT1 genetic polymorphism in Egyptian chronic myeloid leukemia patients.

  2010cites this paper
• Pharmacogenetics of Lung Cancer

  2010cites this paper