Aberrant methylation of the Cyclooxygenase 2 CpG island in colorectal tumors.

No abstract is available for this paper.

• Publication year

  2000

• Venue

  Cancer Research

• Publication date

  2000-08-01

• Fields of study

  Biology, Medicine

• Identifiers
  PMID 10945606
• External record

  Open on Semantic Scholar

• Source metadata

  Semantic Scholar, PubMed

• No claims are published for this paper.

• No concepts are published for this paper.

• Differential expression of cyclooxygenase 2 in human colorectal cancer.

  2000cited by this paper
• Distinct genetic profiles in colorectal tumors with or without the CpG island methylator phenotype.

  2000cited by this paper
• CpG island methylator phenotype in colorectal cancer.

  1999influential reference
• Reduced expression of cyclooxygenase 2 proteins in hereditary nonpolyposis colorectal cancers relative to sporadic cancers.

  1999influential reference
• Extinction of E-cadherin expression in breast cancer via a dominant repression pathway acting on proximal promoter elements

  1999cited by this paper
• The DNA methylation paradox.

  1999cited by this paper
• Relationships between chromatin organization and DNA methylation in determining gene expression.

  1999cited by this paper
• Inactivation of CACNA1G, a T-type calcium channel gene, by aberrant methylation of its 5' CpG island in human tumors.

  1999influential reference
• Differential expression of cyclooxygenase 2 in human colorectal cancer

  1999cited by this paper
• Cancer-epigenetics comes of age

  1999cited by this paper
• Inhibition of Cyclooxygenase-2 Gene Expression by p53*

  1999cited by this paper
• The Role of Cyclooxygenase Inhibition in the Antineoplastic Effects of Nonsteroidal Antiinflammatory Drugs (Nsaids)

  1999cited by this paper
• Overexpression of cyclooxygenase‐2 protein is less frequent in gastric cancers with microsatellite instability

  1999influential reference
• Identification of differentially methylated sequences in colorectal cancer by methylated CpG island amplification.

  1999cited by this paper
• Alterations in DNA methylation: a fundamental aspect of neoplasia.

  1998cited by this paper
• Aging and DNA methylation in colorectal mucosa and cancer.

  1998cited by this paper
• Reduced COX-2 protein in colorectal cancer with defective mismatch repair.

  1998influential reference
• NS398, a selective cyclooxygenase-2 inhibitor, induces apoptosis and down-regulates bcl-2 expression in LNCaP cells.

  1998cited by this paper
• Expression of cyclooxygenase-2 in human lung carcinoma.

  1998cited by this paper
• Expression of cyclooxygenase-2 in human gastric carcinoma.

  1997cited by this paper
• Association between CpG island methylation and microsatellite instability in colorectal cancer.

  1997cited by this paper
• COBRA: a sensitive and quantitative DNA methylation assay.

  1997cited by this paper
• Inhibition of human colon cancer cell growth by selective inhibition of cyclooxygenase-2.

  1997cited by this paper
• Cyclooxygenase-2 expression in human colon cancer cells increases metastatic potential.

  1997cited by this paper
• Suppression of intestinal polyposis in Apc delta716 knockout mice by inhibition of cyclooxygenase 2 (COX-2).

  1996cited by this paper
• Differential expression and regulation of cyclooxygenase-1 and -2 in two human breast cancer cell lines.

  1996cited by this paper
• Suppression of Intestinal Polyposis in ApcΔ716 Knockout Mice by Inhibition of Cyclooxygenase 2 (COX-2)

  1996cited by this paper
• Prostaglandin H synthase 2 is expressed abnormally in human colon cancer: evidence for a transcriptional effect.

  1996cited by this paper
• Aspirin and the risk of colorectal cancer in women.

  1996cited by this paper
• Aspirin and the risk of colorectal cancer in women.

  1995cited by this paper
• Eicosanoids and the gastrointestinal tract.

  1995cited by this paper
• Alterations in cellular adhesion and apoptosis in epithelial cells overexpressing prostaglandin endoperoxide synthase 2.

  1995cited by this paper
• Up-regulation of cyclooxygenase 2 gene expression in human colorectal adenomas and adenocarcinomas.

  1994cited by this paper
• Methylation of the oestrogen receptor CpG island links ageing and neoplasia in human colon

  1994cited by this paper
• A genomic sequencing protocol that yields a positive display of 5-methylcytosine residues in individual DNA strands.

  1992cited by this paper
• CpG islands in vertebrate genomes.

  1987cited by this paper

• 3D Genome Engineering: Current Advances and Therapeutic Opportunities in Human Diseases

  2025cites this paper
• Regulating arachidonic acid metabolism: a novel strategy to prevent colorectal inflammatory cancer transformation

  2025cites this paper
• The mechanisms and drug therapies of colorectal cancer and epigenetics: bibliometrics and visualized analysis

  2024cites this paper
• A novel screening method of DNA methylation biomarkers helps to improve the detection of colorectal cancer and precancerous lesions

  2023cites this paper
• FADS2 function at the major cancer hotspot 11q13 locus alters fatty acid metabolism in cancer.

  2023cites this paper
• Epigenetic Control of Vascular Smooth Muscle Cell Function in Atherosclerosis: A Role for DNA Methylation

  2022cites this paper
• Promoter Gene Methylation Regulates Clooxygenase-2 Expression in Androgen-Dependent and Independent Prostate Cancer Cells

  2022cites this paper
• Colorectal Carcinoma, Cyclooxygenases, and COX Inhibitors

  2022cites this paper
• Circulating Methylated SEPT9 DNA Analyses to Predict Recurrence Risk and Adjuvant Chemotherapy Benefit in Stage II to III Colorectal Cancer

  2022cites this paper
• Current trends in toxicoepigenomics research, limitations and future perspective

  2021cites this paper
• Crosstalk Between Inflammatory Signaling and Methylation in Cancer

  2021cites this paper
• Epigenetic Alterations Upstream and Downstream of p53 Signaling in Colorectal Carcinoma

  2021cites this paper
• Epigenetic regulation of COX-2 expression by DNA hypomethylation via NF-κB activation in ketamine-induced ulcerative cystitis

  2019cites this paper
• Developing DNA methylation-based diagnostic biomarkers.

  2018influential citation
• IL-33 facilitates proliferation of colorectal cancer dependent on COX2/PGE2

  2018cites this paper
• Protein expression of Fragile Histidine Triad and cyclooxgenase-2 in serrated neoplasia of the colorectum.

  2017cites this paper
• Expression of methylation-modulated tumor-related genes in endoscopically resected early esophageal squamous neoplasia

  2017cites this paper
• Cyclical DNA Methylation and Histone Changes Are Induced by LPS to Activate COX-2 in Human Intestinal Epithelial Cells

  2016cites this paper
• Differential sensitivity to methylated DNA by ETS-family transcription factors is intrinsically encoded in their DNA-binding domains

  2016cites this paper
• Coward, William R. and Feghali-Bostwick, Carol A. and Jenkins, Gisli and Knox, Alan J. and Pang, Linhua (2014) A central role for G9a and EZH2 in the epigenetic silencing of cyclooxygenase-2 in idiopathic pulmonary fibrosis

  2016cites this paper
• Epigenetic Regulations of Inflammatory Cyclooxygenase-Derived Prostanoids: Molecular Basis and Pathophysiological Consequences

  2015cites this paper
• Disruption of CTCF/cohesin-mediated high-order chromatin structures by DNA methylation downregulates PTGS2 expression

  2015cites this paper
• Potential of DNA methylation in rectal cancer as diagnostic and prognostic biomarkers

  2015cites this paper
• Faecal Occult Blood Testing for Colorectal Cancer Screening: the Past or the Future

  2015cites this paper
• The transcription factor c-Fos coordinates with histone lysine-specific demethylase 2A to activate the expression of cyclooxygenase-2

  2015cites this paper
• Methylation status of COX-2 in blood leukocyte DNA and risk of gastric cancer in a high-risk Chinese population

  2015cites this paper
• Colorectal Cancer Biomarkers: Where Are We Now?

  2015cites this paper
• Epigenetics override pro-inflammatory PTGS transcriptomic signature towards selective hyperactivation of PGE2 in colorectal cancer

  2015cites this paper
• DNA-hypomethylating agent, 5'-azacytidine, induces cyclooxygenase-2 expression via the PI3-kinase/Akt and extracellular signal-regulated kinase-1/2 pathways in human HT1080 fibrosarcoma cells.

  2015cites this paper
• Methylation Status of Blood Leukocyte DNA and Risk of Gastric Cancer in a High-Risk Chinese Population

  2014cites this paper
• Allelic variation in the canine Cox-2 promoter causes hypermethylation of the canine Cox-2 promoter in clinical cases of renal dysplasia

  2014cites this paper
• p50-associated COX-2 extragenic RNA (PACER) activates COX-2 gene expression by occluding repressive NF-κB complexes

  2014cites this paper
• A central role for G 9 a and EZH 2 in the epigenetic silencing of cyclooxygenase-2 in idiopathic pulmonary fibrosis

  2014cites this paper
• Candidate chromosome 1 disease susceptibility genes for Sjogren's syndrome xerostomia are narrowed by novel NOD.B10 congenic mice.

  2014cites this paper
• Aspirin and esophageal squamous cell carcinoma: bedside to bench

  2014cites this paper
• General introduction: targeting myeloid suppression in cancer immunotherapy

  2014cites this paper
• A central role for G9a and EZH2 in the epigenetic silencing of cyclooxygenase-2 in idiopathic pulmonary fibrosis

  2014cites this paper
• Reasons of carcinogenesis indicate a big-bang inside: a hypothesis for the aberration of DNA methylation.

  2013cites this paper
• Human Cancer Epigenetics

  2013cites this paper
• Molecular Pathology of Colon and Small Bowel Cancers: Sporadic Type

  2013cites this paper
• ATAGTTTTCGAGGGTTATTCGC CCTAAACACAACGCCGACC PRKCB 1 GTATCGCGTTTAGGTTTCGTTT CCGACGCTACAAAACTACGA PROK 2 ATAAAGGTTAGTTTCGTCGTGA ACACGTACTCGTCTAAAAACCG PROP 1 CGAGTTATGGAAGTAGAAAGGAGGC ATAATCGAAATCCCAATAACCGA PTGS 2 TTACGGAAATGAGAAAATCGG GCCTAAAACGATAAAACTCGAAA RASSF 1 GCGTATTGTAGGTTTTTGCGT TAATCCCTAACC

  2013cites this paper
• Mechanistic aspects of COX-2 expression in colorectal neoplasia.

  2013cites this paper
• Hypermethylation of TWIST1 and NID2 in Tumor Tissues and Voided Urine in Urinary Bladder Cancer Patients

  2013cites this paper
• Maintaining the unmethylated state

  2013cites this paper
• Regulatory T cells in cancer: an overview and perspectives on cyclooxygenase-2 and Foxp3 DNA methylation.

  2013cites this paper
• Correlation of epigenetic change and identification of risk factors for oral submucous fibrosis

  2012cites this paper
• Current limitations and future opportunities for epigenetic therapies.

  2012cites this paper
• Multigene Methylation Analysis of Gastrointestinal Tumors

  2012cites this paper
• Epigenetic deregulation of the COX pathway in cancer.

  2012cites this paper
• Genetic and Epigenetic Biomarkers in Cancer

  2012cites this paper
• Malignant Epithelial Neoplasms of the Large Bowel

  2012cites this paper
• Promoter methylation regulates cigarette smoke‐stimulated cyclooxygenase‐2 expression in esophageal squamous cell carcinoma

  2012cites this paper
• Prostaglandin E2 increases fibroblast gene‐specific and global DNA methylation via increased DNA methyltransferase expression

  2012influential citation
• Cross-talk between tumor and myeloid cells: how to tip the balance in favor of antitumor immunity.

  2011cites this paper
• Induction of Cyclooxygenase-2 Expression by Hepatitis B Virus Depends on Demethylation-associated Recruitment of Transcription Factors to the Promoter

  2011cites this paper
• Promoter hypermethylation of cyclooxygenase-2 gene in esophageal squamous cell carcinoma.

  2011cites this paper
• Methylation status and overexpression of COX-2 in Tunisian patients with ductal invasive breast carcinoma

  2011cites this paper
• Arachidonic Acid Metabolites and the Kidney

  2011cites this paper
• COX-2 gene expression in colon cancer tissue related to regulating factors and promoter methylation status

  2011cites this paper
• Potential of a New Blood Test for Colorectal Cancer Screening - The Septin 9 Gene Biomarker

  2010cites this paper
• Methods for DNA methylation analysis and applications in colon cancer.

  2010cites this paper
• Epigenomics of human colon cancer.

  2010cites this paper
• Detection of DNA hypermethylation as a diagnostic tool in cervical neoplasma tool in cervical neoplasia

  2010cites this paper
• Rapid determination of AKAP12 promoter methylation levels in peripheral blood using methylation-sensitive high resolution melting (MS-HRM) analysis: application in colorectal cancer.

  2010cites this paper
• Epigenetics, an Early Event in the Modulation of Gene Expression by Inositol Hexaphosphate in Ethylnitrosourea Exposed Mouse Lungs

  2010cites this paper
• Aberrant epigenetic patterns in the etiology of gastrointestinal cancers

  2010cites this paper
• Epigenetic Regulation of the pKi-67 Gene Promotor : DNA Methylation Analysis of its CpG island

  2010cites this paper
• Cyclooxygenase Isoforms in Tumorigenesis

  2010cites this paper
• Genetic Approaches to Colorectal Cancer

  2010cites this paper
• Untersuchung der Expression von Cyclooxygenase-2, VEGF und der Gefäßdichte im Nierenzellkarzinom

  2010cites this paper
• Epigenetic Changes in Cancer: Role of Environment

  2010cites this paper
• Promoter Methylation of Specific Genes is Associated with the Phenotype and Progression of Colorectal Adenocarcinomas

  2010cites this paper
• Preclinical and clinical studies on the co-regulation of tumor-induced angiogenesis and dendritic cell suppression

  2009cites this paper
• Defective Histone Acetylation Is Responsible for the Diminished Expression of Cyclooxygenase 2 in Idiopathic Pulmonary Fibrosis

  2009influential citation
• Efficient molecular screening of Lynch syndrome by specific 3' promoter methylation of the MLH1 or BRAF mutation in colorectal cancer with high-frequency microsatellite instability.

  2009cites this paper
• Stool Methylation-Specific Polymerase Chain Reaction Assay for the Detection of Colorectal Neoplasia in Korean Patients

  2009cites this paper
• Epigenetic Cross-Talk between DNA Methylation and Histone Modifications in Human Cancers

  2009cites this paper
• Integrated analysis of genetic and epigenetic alterations in cancer.

  2009cites this paper
• DNA Methylation Profiles as Prognostic Markers for Cancer

  2008cites this paper
• DNA methylation biomarkers for blood-based colorectal cancer screening.

  2008cites this paper
• Diffuse Large B Cell Lymphoma Shows Distinct Methylation Profiles of the Tumor Suppressor Genes among the Non-Hodgkin' s Lymphomas

  2008cites this paper
• Cyclooxygenase-2 Expression Is an Independent Predictor of Poor Prognosis in Colon Cancer

  2008cites this paper
• Sensitive Detection of Colorectal Cancer in Peripheral Blood by Septin 9 DNA Methylation Assay

  2008cites this paper
• Novel Insights into the Control of Human Pregnancy: Potential Role(s) for Epigenetic Regulation

  2008cites this paper
• Aberrant crypt foci as precursors in colorectal cancer progression

  2008cites this paper
• EGFR, HER‐2 and COX‐2 levels in colorectal cancer

  2008cites this paper
• Die Methylierung von Serum-DNA ist ein unabhängiger prognostischer Marker des kolorektalen Karzinoms

  2008cites this paper
• Cyclooxygenase-2 overexpression is common in serrated and non-serrated colorectal adenoma, but uncommon in hyperplastic polyp and sessile serrated polyp/adenoma

  2008influential citation
• Estudo da regulaçăo epigenética por metilaçăo do receptor de quimiocinas CXCR4 no câncer de mama

  2008cites this paper
• DNA methylation as a therapeutic target in cancer.

  2008cites this paper
• DNA Methylation in Colorectal cancer—Impact on Screening and Therapy Monitoring Modalities?

  2007influential citation
• DNA Methylation as a Therapeutic Target in Cancer

  2007cites this paper
• Targeting Aberrant Chromatin Structure in Colorectal Carcinomas

  2007cites this paper
• DNA methylation in health, disease, and cancer.

  2007cites this paper
• DNAMethylation as a Therapeutic Target in Cancer

  2007cites this paper
• Extensive methylation is associated with beta-catenin mutations in hepatocellular carcinoma: evidence for two distinct pathways of human hepatocarcinogenesis.

  2007cites this paper
• Prevention of cancer in the upper gastrointestinal tract with COX-inhibition. Still an option?

  2007cites this paper
• Drug sensitivity prediction by CpG island methylation profile in the NCI-60 cancer cell line panel.

  2007cites this paper
• DNA methylation profiles of female steroid hormone-driven human malignancies.

  2006cites this paper
• CpG island methylation in precursors of gastrointestinal malignancies.

  2006cites this paper