Homology between cellulase genes of Trichoderma reesei: complete nucleotide sequence of the endoglucanase I gene.

No abstract is available for this paper.

• Publication year

  1986

• Venue

  Gene

• Publication date

  Unknown publication date

• Fields of study

  Biology, Medicine, Chemistry

• Identifiers
  DOI 10.1016/0378-1119(86)90023-5PMID 2948877
• External record

  Open on Semantic Scholar

• Source metadata

  Semantic Scholar, PubMed

• No claims are published for this paper.

• No concepts are published for this paper.

• Molecular cloning of the 3-phosphoglycerate kinase (PGK) gene from Aspergillus nidulans

  2004cited by this paper
• Sequence of a cellulase gene of the thermophilic bacterium Clostridium thermocellum

  1985cited by this paper
• A new appraisal of the endoglucanases of the fungus Trichoderma reesei.

  1985cited by this paper
• Improved M13 phage cloning vectors and host strains: nucleotide sequences of the M13mp18 and pUC19 vectors.

  1985cited by this paper
• The role of carboxyl groups in the function of endo-beta-1,4-glucanase from Schizophyllum commune.

  1985cited by this paper
• Isolation and structural organization of the Neurospora crassa copper metallothionein gene.

  1985cited by this paper
• Size and position of intervening sequences are critical for the splicing efficiency of pre-mRNA in the yeast Saccharomyces cerevisiae.

  1985cited by this paper
• Synergism of Cellulases from Trichoderma reesei in the Degradation of Cellulose

  1985cited by this paper
• Identification and molecular analysis of a third Aspergillus nidulans alcohol dehydrogenase gene.

  1985cited by this paper
• Sequence analysis of a split gene involved in fruiting from the fungus Schizophyllum commune

  1984cited by this paper
• Molecular Cloning and Characterization of the Glucoamylase Gene of Aspergillus awamori

  1984cited by this paper
• Two different types of intervening sequences in the glucoamylase gene from Aspergillus niger.

  1984cited by this paper
• Intron splicing: a conserved internal signal in introns of animal pre-mRNAs.

  1984cited by this paper
• The primary structure of a 1,4‐β‐glucan cellobiohydrolase from the fungus Trichoderma reesei QM 9414

  1984cited by this paper
• The disulphide bridges in a cellobiohydrolase and an endoglucanase from Trichoderma reesei.

  1984cited by this paper
• A comprehensive sequence analysis program for the IBM personal computer

  1984cited by this paper
• The cellulolytic enzymes of Trichoderma reesei as a system of homologous proteins

  1984cited by this paper
• Two Forms of Endoglucanase from the Basidiomycete Schizophyllum Commune and their Relationship to Other β-1,4-Glycoside Hydrolases

  1984cited by this paper
• The DNA sequence of the gene and genetic control sites for the excreted B. subtilis enzyme beta-glucanase

  1984cited by this paper
• Isolation of cellulolytic enzymes from Trichoderma reesei QM 9414.

  1984cited by this paper
• Evidence for an intron-contained sequence required for the splicing of yeast RNA polymerase II transcripts.

  1983cited by this paper
• The genes coding for histone H3 and H4 in Neurospora crassa are unique and contain intervening sequences.

  1983cited by this paper
• The complete nucleotide sequence of the Neurospora crassa am (NADP-specific glutamate dehydrogenase) gene.

  1983cited by this paper
• Evidence for the biochemical role of an internal sequence in yeast nuclear mRNA introns: implications for U1 RNA and metazoan mRNA splicing.

  1983cited by this paper
• Molecular Cloning of Exo–Cellobiohydrolase I Derived from Trichoderma Reesei Strain L27

  1983cited by this paper
• The Molecular Cloning of the Major Cellulase Gene from Trichoderma Reesei

  1983cited by this paper
• A fungal cellulase shows sequence homology with the active site of hen egg-white lysozyme.

  1983cited by this paper
• Cellobiohydrolase from Trichoderma reesei.

  1983cited by this paper
• Characterization and Properties of Cellulases Purified from Trichoderma Reesei Strain L27

  1983cited by this paper
• The complete amino acid sequence of the glycoprotein, glucoamylase G1, from Aspergillus niger

  1983cited by this paper
• Trichoderma reesei cellulases

  1983cited by this paper
• [24] Plasmid screening at high colony density

  1983cited by this paper
• Plasmid screening at high colony density.

  1983cited by this paper
• The imported preprotein of the proteolipid subunit of the mitochondrial ATP synthase from Neurospora crassa. Molecular cloning and sequencing of the mRNA.

  1982cited by this paper
• The primary structure of the Saccharomyces cerevisiae gene for alcohol dehydrogenase.

  1982cited by this paper
• Codon selection in yeast.

  1982cited by this paper
• Protein folding.

  1981cited by this paper
• Prediction of protein antigenic determinants from amino acid sequences.

  1981cited by this paper
• Induction, isolation and testing of stable Trichoderma reesei mutants with improved production of solubilizing cellulase

  1981cited by this paper
• Cellulases: Biosynthesis and applications

  1980cited by this paper
• Plasmid screening at high colony density.

  1980cited by this paper
• Isolation of biologically active ribonucleic acid from sources enriched in ribonuclease.

  1979cited by this paper
• A 1,4-beta-glucan glucanohydrolase from the cellulolytic fungus Trichoderma viride QM 9414. Purification, characterization and preparation of an immunoadsorbent for the enzyme.

  1979cited by this paper
• Analysis of the accuracy and implications of simple methods for predicting the secondary structure of globular proteins.

  1978cited by this paper
• DNA sequencing with chain-terminating inhibitors.

  1977cited by this paper
• Structural characterization of a glycoprotein cellulase, 1,4-beta-D-glucan cellobiohydrolase C from Trichoderma viride.

  1976cited by this paper
• Glycoproteins.

  1973cited by this paper
• Cleavage of Structural Proteins during the Assembly of the Head of Bacteriophage T4

  1970cited by this paper
• Enzymatic Hydrolysis of Cellulose

  1956cited by this paper

• Theoretical insights into the impact of cholinium amino acid-based ionic liquids on enzymatic activity of cellulases.

  2025cites this paper
• Creating a novel genetic diversity of Trichoderma afroharzianum by γ-radiation for xylanase-cellulase production

  2024cites this paper
• Assessing the compatibility of choline-based deep eutectic solvents for the structural stability and activity of cellulase: Enzyme sustain at high temperature.

  2023cites this paper
• Stochastic model of lignocellulosic material saccharification

  2021cites this paper
• Filamentous fungi isolated from Tunisian olive mill wastes: use of solid-state fermentation for enzyme production

  2021cites this paper
• Extracellular Carbohydrate-Active Enzymes of Trichoderma and Their Role in the Bioconversion of Non-edible Biomass to Biofuel

  2019cites this paper
• Enzymes in Winemaking: Harnessing Natural Catalysts for Efficient Biotransf ormations - A Review

  2019cites this paper
• Cellulase production, recovery, formulation and application : a wastewater biorefinery approach

  2018cites this paper
• Engineering of the Trichoderma reesei xylanase3 promoter for efficient enzyme expression

  2018cites this paper
• Cellulose-binding activity of a 21-kDa endo-ß-1,4-glucanase lacking cellulose-binding domain and its synergy with other cellulases in the digestive fluid of Aplysia kurodai

  2018cites this paper
• Systematic deletions in the cellobiohydrolase (CBH) Cel7A from the fungus Trichoderma reesei reveal flexible loops critical for CBH activity

  2018cites this paper
• United States Patent ( 10 ) Patent No . : US 7 , 323 , 326 B 2

  2017cites this paper
• United States Patent ( 10 ) Patent No . : US 7 , 960 , 146 B 2

  2017cites this paper
• HeteroJogous Expression from 71 itichoderma virideand Characterization f HK-75 Endoglucanase I ( EGI )

  2017cites this paper
• Gapped BLAST and PSI BLAST : a new generation of protein database search pro grams

  2017cites this paper
• Improving the activity of endoglucanase I (EGI) from Saccharomyces cerevisiae by DNA shuffling

  2017cites this paper
• Production of isoprene, one of the high-density fuel precursors, from peanut hull using the high-efficient lignin-removal pretreatment method

  2017cites this paper
• A Review of natural and engineered enzymes involved in bioethanol production

  2016cites this paper
• A method for isolation of soil microbial DNA that is suitable for analysis of microbial cellulase genes

  2016cites this paper
• Proper ultrasound treatment increases ethanol production from simultaneous saccharification and fermentation of sugarcane bagasse

  2016cites this paper
• Hydrolytic effects of scaffolding proteins CbpB and CbpC on crystalline cellulose mediated by the major cellulolytic complex from Clostridium cellulovorans.

  2015cites this paper
• Fungal cellulases.

  2015cites this paper
• Screening, identification, and characterization of a GH43 family β-xylosidase/α-arabinofuranosidase from a compost microbial metagenome

  2015cites this paper
• Beta-Glucosidase from Trichoderma to Improve the Activity of Cellulase Cocktails

  2014cites this paper
• CELLULOLYTIC ASPERGILLUS FLAVUS ISOLATED FROM ENVIRONMENTAL SAMPLE IN GHANA

  2014cites this paper
• Trichoderma in Bioenergy Research

  2014cites this paper
• The synergistic interactions of Trichoderma spp. cellulase enzyme activities in biomass conversion; Part 1: comparison of cellulose Iα, Iβ and III.

  2014cites this paper
• The significance of cellulolytic enzymes produced by Trichoderma in opportunistic lifestyle of this fungus

  2014cites this paper
• Trichoderma Proteins with Disruption Activity on Cellulosic Substrates

  2014cites this paper
• Sequence Analysis of Industrially Important Genes from Trichoderma

  2014cites this paper
• The impact of extracellular enzymes of Trichoderma viride and Trichoderma harzianum on succinoglycan produced from Agrobacterium radiobacter

  2014cites this paper
• Structural and functional stability of cellulase in aqueous-biamphiphilic ionic liquid surfactant solution.

  2014cites this paper
• The slowdown of the endoglucanase Trichoderma reesei Cel5A-catalyzed cellulose hydrolysis is related to its initial activity.

  2014cites this paper
• Enzymatic hydrolysis of cellulose in aqueous ionic liquids

  2014cites this paper
• Transcriptional analysis of Trichoderma reesei under conditions inducing cellulase and hemicellulase production, and identification of factors influencing protein production

  2014influential citation
• Protein Production—Quality Control and Secretion Stress Responses in Trichoderma reesei

  2014cites this paper
• Variant de champignon producteur de cellulase, procédé de fabrication de cellulase, et procédé de fabrication de cello-oligosaccharides

  2014cites this paper
• Cloning, expression, and characterization of a thermostable GH7 endoglucanase from Myceliophthora thermophila capable of high-consistency enzymatic liquefaction

  2013cites this paper
• Lignocellulose Conversion

  2013cites this paper
• The Saccharification Step: Trichoderma Reesei Cellulase Hyper Producer Strains

  2013cites this paper
• families.conservation, function, and enzyme Domains in microbial beta-1, 4-glycanases:

  2013cites this paper
• Single Nucleotide Polymorphism Analysis of a Trichoderma reesei Hyper-Cellulolytic Mutant Developed in Japan

  2013cites this paper
• Fungal Laccases: Structure, Function and Application

  2013cites this paper
• Binding site dynamics and aromatic-carbohydrate interactions in processive and non-processive family 7 glycoside hydrolases.

  2013cites this paper
• Biochemical Conversions of Lignocellulosic Biomass for Sustainable Fuel-Ethanol Production in the Upper Midwest

  2012influential citation
• Etude de la saccharification enzymatique du miscanthus par les cocktails cellulolytiques de Trichoderma reesei

  2012cites this paper
• Ras GTPases Modulate Morphogenesis, Sporulation and Cellulase Gene Expression in the Cellulolytic Fungus Trichoderma reesei

  2012cites this paper
• The cargo and the transport system: secreted proteins and protein secretion in Trichoderma reesei (Hypocrea jecorina).

  2012cites this paper
• Molecular simulation study with complex models of the carbohydrate binding module of Cel6A and the cellulose Iα crystal

  2012cites this paper
• Enhanced Saccharification by Trichoderma reesei Expressing a β-Glucosidase from Magnaporthe oryzae

  2012cites this paper
• Re-annotation of the CAZy genes of Trichoderma reesei and transcription in the presence of lignocellulosic substrates

  2012cites this paper
• Isothermal microwave biology : catalysis and fermentation

  2012cites this paper
• Heterologous Expression Characteristics of Trichoderma viride Endoglucanase V in the Silkworm, Bombyx mori L.

  2011cites this paper
• Fungal Degradation of Plant Bacterial Strategies for Plant

  2011cites this paper
• Screening of Wild-Type Fungal Isolates for Cellulolytic Activity

  2011cites this paper
• Isolation of a novel promoter for efficient protein expression by Aspergillus oryzae in solid-state culture

  2011cites this paper
• A modified expression of the major hydrolase activator in Hypocrea jecorina (Trichoderma reesei) changes enzymatic catalysis of biopolymer degradation

  2011cites this paper
• Microbial Utilization of Agronomic Wastes for Cellulase Production by Aspergillus niger and Trichoderma viride Using Solid-State Fermentation

  2011cites this paper
• Expression of Trichodermaviride endoglucanase III in the larvae of silkworm, Bombyx mori L. and characteristic analysis of the recombinant protein

  2011cites this paper
• Inhibition of enzymatic hydrolysis by residual lignins from softwood—study of enzyme binding and inactivation on lignin‐rich surface

  2011cites this paper
• Origin of Initial Burst in Activity for Trichoderma reesei endo-Glucanases Hydrolyzing Insoluble Cellulose*

  2011cites this paper
• Molecular Cloning and Characterization of a Putative cDNA Encoding Endoglucanase IV from Trichoderma Viride and its Expression in Bombyx Mori

  2011cites this paper
• Trichoderma reesei as an expression system for homologous production of individual cellulases

  2010cites this paper
• Cellotriose and Cellotetraose as Inducers of the Genes Encoding Cellobiohydrolases in the Basidiomycete Phanerochaete chrysosporium

  2010cites this paper
• Enhanced cellulase production of the Trichoderma viride mutated by microwave and ultraviolet.

  2010cites this paper
• Molecular cloning, gene expression analysis and structural modelling of the cellobiohydrolase I from Penicillium occitanis

  2010cites this paper
• Cloning and expression of a cellulase gene in the silkworm, Bombyx mori by improved Bac-to-Bac/BmNPV baculovirus expression system

  2010cites this paper
• Bioenergy: Sustainable fuels from biomass by yeast and fungal whole-cell biocatalysts

  2009cites this paper
• Secretory pathway of the filamentous fungus Trichoderma reesei

  2009cites this paper
• Quantitative transcriptional analysis of the genes encoding glycoside hydrolase family 7 cellulase isozymes in the basidiomycete Phanerochaete chrysosporium.

  2009cites this paper
• Identification of specific binding sites for XYR1, a transcriptional activator of cellulolytic and xylanolytic genes in Trichoderma reesei.

  2009cites this paper
• The most stirring technology in future: cellulase enzyme and biomass utilization.

  2009cites this paper
• Novel Coprinopsis cinerea Polyesterase That Hydrolyzes Cutin and Suberin

  2009cites this paper
• ACTGAGCATTGGCACACTT TACAAAAGCTACTACG CTGGTACTTGCGGGTGAT CTCAACAAGCTCATCAA TCTTCAACGGAGGATAAACC CCGAATCATGTCAC GACGTTGACTGTTCCCTGT GTAGTGGGCTGGACG ATAGTGTCTCCGGCCTTG AGCATCATCGTCA CGAAATGGTAGCTGTAGCC CTATCCGACTGAGAC GAGGCGCTTGATGAGAC CAACCAGGGCAAC CACGCACTGAGGATAGTTCT CCTTCAACGACTT CGCTAATGGCCTTGTTCT

  2009cites this paper
• Cellulase Production by Trichoderma Reesei Rut-C30

  2008cites this paper
• Biomass degrading enzymes from Penicillium – cloning and characterization

  2008influential citation
• Biochemical and molecular characterization of a putative endoglucanase in Magnaporthegrisea

  2008cites this paper
• Bioconversion of biodegradable municipal solid waste (BMSW) to glucose for bio-ethanol production

  2008cites this paper
• Transcriptional Regulation of xyr1, Encoding the Main Regulator of the Xylanolytic and Cellulolytic Enzyme System in Hypocrea jecorina

  2008cites this paper
• Chrysosporium lucknowense Cellulases and Xylanases in Cellulosic Biofuels Production

  2008cites this paper
• Correlation between cellulose binding and activity of cellulose‐binding domain mutants of Humicola grisea cellobiohydrolase 1

  2007cites this paper
• Evaluation of Minimal Trichoderma reesei Cellulase Mixtures on Differently Pretreated Barley Straw Substrates

  2007cites this paper
• Expression of an AT-rich xylanase gene from the anaerobic fungus Orpinomyces sp. strain PC-2 in and secretion of the heterologous enzyme by Hypocrea jecorina

  2007cites this paper
• Digital Comprehensive Summaries of Uppsala Dissertations from the Faculty of Science and Technology 185 Hydrolytic and Oxidative Mechanisms Involved in Cellulose Degradation

  2006cites this paper
• Xyr1 (Xylanase Regulator 1) Regulates both the Hydrolytic Enzyme System and d-Xylose Metabolism in Hypocrea jecorina

  2006cites this paper
• A complete protein pattern of cellulase and hemicellulase genes in the filamentous fungus Trichoderma reesei.

  2006cites this paper
• Transcriptional Regulation of xyn1, Encoding Xylanase I, in Hypocrea jecorina

  2006influential citation
• Xylanases, xylanase families and extremophilic xylanases.

  2005cites this paper
• Transglucosidic reactions of the Aspergillus niger family 3 beta-glucosidase: qualitative and quantitative analyses and evidence that the transglucosidic rate is independent of pH.

  2005cites this paper
• Enhanced production of cellobiohydrolases in Trichoderma reesei and evaluation of the new preparations in biofinishing of cotton.

  2005cites this paper
• Molecular cloning and sequence analysis of the cellobiohydrolase i gene fromTrichoderma koningii G-39

  2005cites this paper
• Enzymes for improved hydrolysis of lignocellulosics Doctoral dissertation Tamás Juhász

  2005cites this paper
• Transcriptional regulation of plant cell wall degradation by filamentous fungi.

  2005cites this paper
• Secretion of a heat-stable fungal β-glucanase from transgenic, suspension-cultured barley cells

  2005cites this paper
• A mannanase, ManA, of the polycentric anaerobic fungus Orpinomyces sp. strain PC-2 has carbohydrate binding and docking modules.

  2005cites this paper
• Directed evolution for engineering pH profile of endoglucanase III from Trichoderma reesei.

  2005cites this paper
• Tolerance mechanisms of streptococci to hydrolysable and condensed tannins

  2005cites this paper
• A novel cellulase gene from the mulberry longicorn beetle, Apriona germari: gene structure, expression, and enzymatic activity.

  2005cites this paper
• Structural and biochemical studies of GH family 12 cellulases: improved thermal stability, and ligand complexes.

  2005cites this paper
• 12 - Combination of Suppression Subtractive Hybridization and Microarray Technologies to Enumerate Biomass-Induced Genes in the Cellulolytic Fungus Trichoderma reesei

  2005cites this paper