Alternative mRNA Splicing Produces a Novel Biologically Active Short Isoform of PGC-1α*

The transcriptional co-activator PGC-1α regulates functional plasticity in adipose tissue by linking sympathetic input to the transcriptional program of adaptive thermogenesis. We report here a novel truncated form of PGC-1α (NT-PGC-1α) produced by alternative 3′ splicing that introduces an in-frame stop codon into PGC-1α mRNA. The expressed protein includes the first 267 amino acids of PGC-1α and 3 additional amino acids from the splicing insert. NT-PGC-1α contains the transactivation and nuclear receptor interaction domains but is missing key domains involved in nuclear localization, interaction with other transcription factors, and protein degradation. Expression and subcellular localization of NT-PGC-1α are dynamically regulated in the context of physiological signals that regulate full-length PGC-1α, but the truncated domain structure conveys unique properties with respect to protein-protein interactions, protein stability, and recruitment to target gene promoters. Therefore, NT-PGC-1α is a co-expressed, previously unrecognized form of PGC-1α with functions that are both unique from and complementary to PGC-1α.

• Publication year

  2009

• Venue

  Journal of Biological Chemistry

• Publication date

  2009-09-22

• Fields of study

  Biology, Medicine

• Identifiers
  DOI 10.1074/jbc.M109.037556PMID 19773550PMCID PMC2781698
• External record

  Open on Semantic Scholar

• Source metadata

  Semantic Scholar, PubMed

• No claims are published for this paper.

• No concepts are published for this paper.

• A PGC-1α-O-GlcNAc Transferase Complex Regulates FoxO Transcription Factor Activity in Response to Glucose*

  2009cited by this paper
• Isoform-specific increases in murine skeletal muscle peroxisome proliferator-activated receptor-gamma coactivator-1alpha (PGC-1alpha) mRNA in response to beta2-adrenergic receptor activation and exercise.

  2008cited by this paper
• Dynamic repertoire of a eukaryotic transcriptome surveyed at single-nucleotide resolution

  2008cited by this paper
• SCFCdc4 acts antagonistically to the PGC-1alpha transcriptional coactivator by targeting it for ubiquitin-mediated proteolysis.

  2008cited by this paper
• Tissue-specific splicing factor gene expression signatures

  2008cited by this paper
• AMP-activated protein kinase (AMPK) action in skeletal muscle via direct phosphorylation of PGC-1alpha.

  2007cited by this paper
• Intramolecular Control of Protein Stability, Subnuclear Compartmentalization, and Coactivator Function of Peroxisome Proliferator-activated Receptor γ Coactivator 1α*

  2007cited by this paper
• Metabolic control of muscle mitochondrial function and fatty acid oxidation through SIRT1/PGC‐1α

  2007cited by this paper
• Akt/PKB regulates hepatic metabolism by directly inhibiting PGC-1α transcription coactivator

  2007cited by this paper
• Why Do We Still Have a Maternally Inherited Mitochondrial DNA ? Insights from Evolutionary Medicine

  2007cited by this paper
• Intramolecular control of protein stability, subnuclear compartmentalization, and coactivator function of peroxisome proliferator-activated receptor gamma coactivator 1alpha.

  2007cited by this paper
• AMP-activated protein kinase (AMPK) action in skeletal muscle via direct phosphorylation of PGC-1α

  2007cited by this paper
• Hepatocyte nuclear factor-4α contributes to carbohydrate-induced transcriptional activation of hepatic fatty acid synthase

  2006cited by this paper
• Hepatocyte nuclear factor-4alpha contributes to carbohydrate-induced transcriptional activation of hepatic fatty acid synthase.

  2006cited by this paper
• Suppression of reactive oxygen species and neurodegeneration by the PGC-1 transcriptional coactivators.

  2006cited by this paper
• Activation of nuclear receptor coactivator PGC-1alpha by arginine methylation.

  2005cited by this paper
• Activation of nuclear receptor coactivator PGC-1α by arginine methylation

  2005cited by this paper
• PGC-1α Deficiency Causes Multi-System Energy Metabolic Derangements: Muscle Dysfunction, Abnormal Weight Control and Hepatic Steatosis

  2005cited by this paper
• Nutrient control of glucose homeostasis through a complex of PGC-1α and SIRT1

  2005cited by this paper
• Targeted deletion of melanocortin receptor subtypes 3 and 4, but not CART, alters nutrient partitioning and compromises behavioral and metabolic responses to leptin

  2005cited by this paper
• Nutrient control of glucose homeostasis through a complex of PGC-1alpha and SIRT1.

  2005cited by this paper
• Pioglitazone induces mitochondrial biogenesis in human subcutaneous adipose tissue in vivo.

  2005cited by this paper
• SIRT1 Functionally Interacts with the Metabolic Regulator and Transcriptional Coactivator PGC-1α*

  2005cited by this paper
• p38 Mitogen-Activated Protein Kinase Is the Central Regulator of Cyclic AMP-Dependent Transcription of the Brown Fat Uncoupling Protein 1 Gene

  2004cited by this paper
• Defects in Adaptive Energy Metabolism with CNS-Linked Hyperactivity in PGC-1 Null Mice

  2004cited by this paper
• Defects in adaptive energy metabolism with CNS-linked hyperactivity in PGC-1alpha null mice.

  2004cited by this paper
• Widespread predicted nonsense-mediated mRNA decay of alternatively-spliced transcripts of human normal and disease genes

  2003cited by this paper
• Regulation of hepatic fasting response by PPARγ coactivator-1α (PGC-1): Requirement for hepatocyte nuclear factor 4α in gluconeogenesis

  2003cited by this paper
• Regulation of hepatic fasting response by PPARgamma coactivator-1alpha (PGC-1): requirement for hepatocyte nuclear factor 4alpha in gluconeogenesis.

  2003cited by this paper
• Peroxisome proliferator-activated receptor-gamma coactivator 1 alpha (PGC-1 alpha): transcriptional coactivator and metabolic regulator.

  2003cited by this paper
• Genome-Wide Survey of Human Alternative Pre-mRNA Splicing with Exon Junction Microarrays

  2003cited by this paper
• Insulin-regulated hepatic gluconeogenesis through FOXO1–PGC-1α interaction

  2003cited by this paper
• Insulin-regulated hepatic gluconeogenesis through FOXO1-PGC-1alpha interaction.

  2003cited by this paper
• Coordination of p300-mediated chromatin remodeling and TRAP/mediator function through coactivator PGC-1alpha.

  2003cited by this paper
• Peroxisome Proliferator-activated Receptor (PPAR) γ Coactivator-1 Recruitment Regulates PPAR Subtype Specificity*

  2002cited by this paper
• Evidence for the widespread coupling of alternative splicing and nonsense-mediated mRNA decay in humans

  2002cited by this paper
• Transcriptional co-activator PGC-1 alpha drives the formation of slow-twitch muscle fibres.

  2002cited by this paper
• Transcriptional co-activator PGC-1α drives the formation of slow-twitch muscle fibres

  2002cited by this paper
• Regulatory Motifs for CREB-binding Protein and Nfe2l2 Transcription Factors in the Upstream Enhancer of the Mitochondrial Uncoupling Protein 1 Gene*

  2002cited by this paper
• Control of hepatic gluconeogenesis through the transcriptional coactivator PGC-1

  2001cited by this paper
• CREB regulates hepatic gluconeogenesis through the coactivator PGC-1

  2001cited by this paper
• Regulation of Nuclear Localization during Signaling*

  2001cited by this paper
• Essential Role of Insulin Receptor Substrate 1 in Differentiation of Brown Adipocytes

  2001cited by this paper
• Regulation of the transcriptional coactivator PGC-1 via MAPK-sensitive interaction with a repressor

  2001cited by this paper
• Cytokine stimulation of energy expenditure through p38 MAP kinase activation of PPARgamma coactivator-1.

  2001cited by this paper
• Restoration of insulin-sensitive glucose transporter (GLUT4) gene expression in muscle cells by the transcriptional coactivator PGC-1

  2001cited by this paper
• Direct coupling of transcription and mRNA processing through the thermogenic coactivator PGC-1.

  2000cited by this paper
• The Coactivator PGC-1 Cooperates with Peroxisome Proliferator-Activated Receptor α in Transcriptional Control of Nuclear Genes Encoding Mitochondrial Fatty Acid Oxidation Enzymes

  2000cited by this paper
• Peroxisome proliferator-activated receptor gamma coactivator-1 promotes cardiac mitochondrial biogenesis.

  2000cited by this paper
• Activation of PPARgamma coactivator-1 through transcription factor docking.

  1999cited by this paper
• Activation of PPARγ coactivator-1 through transcription factor docking

  1999cited by this paper
• Induction of uncoupling protein expression in brown and white adipose tissue by leptin.

  1999cited by this paper
• Mechanisms controlling mitochondrial biogenesis and respiration through the thermogenic coactivator PGC-1.

  1999cited by this paper
• β3-Adrenergic Stimulation Differentially Inhibits Insulin Signaling and Decreases Insulin-induced Glucose Uptake in Brown Adipocytes*

  1999cited by this paper
• A cold-inducible coactivator of nuclear receptors linked to adaptive thermogenesis.

  1998cited by this paper
• A rule for termination-codon position within intron-containing genes: when nonsense affects RNA abundance.

  1998cited by this paper

• [Ligand-dependent and -independent subcellular/subnuclear dynamics uncover new functional roles of ERRs in endocrine and metabolic regulation].

  2026cites this paper
• A key role of the PGC-1α/ERR-α pathway in regulation of angiogenic factors in proliferative diabetic retinopathy

  2025cites this paper
• Cold-inducible GOT1 activates the malate-aspartate shuttle in brown adipose tissue to support fuel preference for fatty acids.

  2025cites this paper
• A postnatal molecular switch drives activity-dependent maturation of parvalbumin interneurons.

  2025cites this paper
• Alterations of the skeletal muscle nuclear proteome after acute exercise reveals a post-transcriptional influence.

  2025cites this paper
• The β-adrenergic receptor-SGK1 signaling pathway in brown adipocytes protects GOT1 from proteasomal degradation

  2025cites this paper
• The AMPK Pathway: Molecular Rejuvenation of Metabolism and Mitochondria

  2025cites this paper
• PGC-1α: key regulator of mitochondrial biogenesis and cellular differentiation in metabolic and regenerative tissues

  2025cites this paper
• Cold-induced expression of a truncated adenylyl cyclase 3 acts as rheostat to brown fat function

  2024cites this paper
• Alternative Splicing Landscape in Mouse Skeletal Muscle and Adipose Tissue: Effects of Intermittent Fasting and Exercise.

  2024cites this paper
• Commercially available PGC-1α antibodies vary greatly in specificity and sensitivity

  2024cites this paper
• Dietary “Beigeing” Fat Contains More Phosphatidylserine and Enhances Mitochondrial Function while Counteracting Obesity

  2024cites this paper
• Reduced Liver Mitochondrial Energy Metabolism Impairs Food Intake Regulation Following Gastric Preloads and Fasting

  2024cites this paper
• Metabolic reprogramming via an engineered PGC-1α improves human chimeric antigen receptor T-cell therapy against solid tumors

  2023cites this paper
• AAV‐Mediated nuclear localized PGC1α4 delivery in muscle ameliorates sarcopenia and aging‐associated metabolic dysfunctions

  2023cites this paper
• PGC-1α Is a Master Regulator of Mitochondrial Lifecycle and ROS Stress Response

  2023cites this paper
• Adipose tissue plasticity in pheochromocytoma patients suggests a role of the splicing machinery in human adipose browning

  2023influential citation
• Induction of lysosomal and mitochondrial biogenesis by AMPK phosphorylation of FNIP1

  2023cites this paper
• New mutant alleles for Spargel/dPGC-1 highlights the function of Spargel RRM domain in oogenesis and expands the role of Spargel in embryogenesis and intracellular transport

  2023cites this paper
• PGC-1α affects skeletal muscle and adipose tissue development by regulating mitochondrial biogenesis

  2022cites this paper
• PGC-1α4 Interacts with REST to Upregulate Neuronal Genes and Augment Energy Consumption in Developing Cardiomyocytes

  2022cites this paper
• Mitochondria homeostasis: Biology and involvement in hepatic steatosis to NASH

  2022cites this paper
• Transcription Factor Movement and Exercise-Induced Mitochondrial Biogenesis in Human Skeletal Muscle: Current Knowledge and Future Perspectives

  2022cites this paper
• PGC-1s in the Spotlight with Parkinson’s Disease

  2021cites this paper
• NT-PGC-1α deficiency attenuates high-fat diet-induced obesity by modulating food intake, fecal fat excretion and intestinal fat absorption

  2021cites this paper
• Selective Activation of CNS and Reference PPARGC1A Promoters Is Associated with Distinct Gene Programs Relevant for Neurodegenerative Diseases

  2021cites this paper
• Fetal Cardiac Lipid Sensing Triggers an Early and Sex-Related Metabolic Energy Switch in Intrauterine Growth Restriction.

  2021cites this paper
• Effect of Periodized Resistance Training on Skeletal Muscle During Androgen Deprivation Therapy for Prostate Cancer: A Pilot Randomized Trial

  2021cites this paper
• Molecular dynamics of estrogen-related receptors and their regulatory proteins: roles in transcriptional control for endocrine and metabolic signaling

  2021cites this paper
• Estrogen-related receptor alpha (ERRα) is required for PGC-1α-dependent gene expression in the mouse brain.

  2021cites this paper
• Mitochondrial Biogenesis and Dynamics in Health and Disease

  2021cites this paper
• Protein Kinase SGK2 Is Induced by the β3 Adrenergic Receptor-cAMP-PKA-PGC-1α/NT-PGC-1α Axis but Dispensable for Brown/Beige Adipose Tissue Thermogenesis

  2021cites this paper
• THE PRECLINICAL STUDY OF THE EXPRESSION CHANGES OF PGC-1α AND SIRT GENES

  2020cites this paper
• Exercise- and Cold-Induced Human PGC-1α mRNA Isoform Specific Responses

  2020cites this paper
• Novel metabolic system for lactic acid via LRPGC1/ERRγ signaling pathway

  2020cites this paper
• Multiple Levels of PGC-1α Dysregulation in Heart Failure

  2020cites this paper
• Nutritional regulation of mitochondrial biogenic energy-sensing pathways in skeletal muscle following endurance exercise

  2019cites this paper
• The effect of physical stimuli on the expression level of key elements in mitochondrial biogenesis.

  2019cites this paper
• Overexpression of both full-length and truncated isoforms of bovine PGC-1alpha enhances myoblasts differentiation

  2019cites this paper
• The PPARGC1A locus and CNS-specific PGC-1α isoforms are associated with Parkinson's Disease.

  2019cites this paper
• The Expression of CNS-Specific PPARGC1A Transcripts Is Regulated by Hypoxia and a Variable GT Repeat Polymorphism

  2019cites this paper
• Role of PGC-1α in Mitochondrial Quality Control in Neurodegenerative Diseases

  2019cites this paper
• A CRM1 Inhibitor Alleviates Cardiac Hypertrophy and Increases the Nuclear Distribution of NT-PGC-1α in NRVMs

  2019influential citation
• 1 PGC-1 α isoforms coordinate to balance hepatic metabolism and apoptosis in inflammatory 1 environments 2 3

  2019cites this paper
• An Optimized Immunoblotting Protocol for Accurate Detection of Endogenous PGC-1α Isoforms in Various Rodent Tissues.

  2019cites this paper
• PGC-1α isoforms coordinate to balance hepatic metabolism and apoptosis in inflammatory environments

  2019influential citation
• Posttranslational regulation of PGC‐1α and its implication in cancer metabolism

  2019cites this paper
• Aberrant expression of alternative isoforms of transcription factors in hepatocellular carcinoma

  2018cites this paper
• Alternative splicing isoforms in health and disease

  2018cites this paper
• A truncated PPAR gamma 2 localizes to mitochondria and regulates mitochondrial respiration in brown adipocytes

  2018cites this paper
• A map of the PGC-1α- and NT-PGC-1α-regulated transcriptional network in brown adipose tissue

  2018cites this paper
• N-terminal truncated peroxisome proliferator-activated receptor-γ coactivator-1α alleviates phenylephrine-induced mitochondrial dysfunction and decreases lipid droplet accumulation in neonatal rat cardiomyocytes

  2018influential citation
• A new AMPK activator, GSK773, corrects fatty acid oxidation and differentiation defect in CPT2-deficient myotubes

  2018cites this paper
• NT-PGC-1α deficiency decreases mitochondrial FA oxidation in brown adipose tissue and alters substrate utilization in vivo[S]

  2018cites this paper
• PGC-1α Protects RPE Cells of the Aging Retina against Oxidative Stress-Induced Degeneration through the Regulation of Senescence and Mitochondrial Quality Control. The Significance for AMD Pathogenesis

  2018cites this paper
• Systematic evaluation of isoform function in literature reports of alternative splicing

  2018cites this paper
• Targeting mitochondrial quality control for treating sarcopenia: lessons from physical exercise

  2018cites this paper
• Specific mitochondrial biogenesis patterns drive nutrient choice in breast cancer subtypes

  2017cites this paper
• Impact of Aging and Exercise on Mitochondrial Quality Control in Skeletal Muscle

  2017cites this paper
• O-GlcNAcylation mediates the control of cytosolic phosphoenolpyruvate carboxykinase activity via Pgc1α

  2017cites this paper
• An unexpected role for the transcriptional coactivator isoform NT-PGC-1α in the regulation of mitochondrial respiration in brown adipocytes

  2017cites this paper
• Effect of MPTP on mRNA expression of PGC-1α in mouse brain.

  2017cites this paper
• Effects of Conjugated Linoleic Acid Associated With Endurance Exercise on Muscle Fibres and Peroxisome Proliferator‐Activated Receptor γ Coactivator 1 α Isoforms

  2017cites this paper
• Dopamine directly increases mitochondrial mass and thermogenesis in brown adipocytes.

  2017cites this paper
• Neurturin is a PGC-1α1-controlled myokine that promotes motor neuron recruitment and neuromuscular junction formation

  2017cites this paper
• PGC-1α and exercise intensity dependent adaptations in mouse skeletal muscle

  2017cites this paper
• Histone Deacetylase 3 And The Epigenomic Regulation Of Brown Adipose Physiology

  2017cites this paper
• Quercetin and Quercetin-Rich Red Onion Extract Alter Pgc-1α Promoter Methylation and Splice Variant Expression

  2017cites this paper
• Neuropathological characterization of FL-PGC-1α-deficient mice – implications for mitochondrial encephalopathy

  2016cites this paper
• Regulation of Brown and White Adipocyte Transcriptome by the Transcriptional Coactivator NT-PGC-1α

  2016influential citation
• Transcriptional coactivator NT‐PGC‐1α promotes gluconeogenic gene expression and enhances hepatic gluconeogenesis

  2016influential citation
• Unravelling the mechanisms regulating muscle mitochondrial biogenesis.

  2016cites this paper
• A key role of PGC‐1α transcriptional coactivator in production of VEGF by a novel angiogenic agent COA‐Cl in cultured human fibroblasts

  2016influential citation
• Peroxisome Proliferator-activated Receptor γ Coactivator-1 α Isoforms Selectively Regulate Multiple Splicing Events on Target Genes*

  2016cites this paper
• Effects of chemotherapy and blocking activin receptor signaling on skeletal muscle size, oxidative capacity and function

  2016influential citation
• Neuroprotective effects of PGC-1α activators in dopaminergic neurons

  2016cites this paper
• Perm1 enhances mitochondrial biogenesis, oxidative capacity, and fatigue resistance in adult skeletal muscle

  2016cites this paper
• High‐throughput RNA sequencing reveals structural differences of orthologous brain‐expressed genes between western lowland gorillas and humans

  2016cites this paper
• Epigenetic Modifications of the PGC-1α Promoter during Exercise Induced Expression in Mice

  2015influential citation
• PPARβ/δOverexpression Increase PGC-1αProtein through the Decreased PGC-1αUbiquitination in Mouse Skeletal Muscle

  2015cites this paper
• Transcriptional regulation of kidney and skeletal muscle metabolism by the coactivator PGC-1α

  2015cites this paper
• 1 ( MHCIIx ) TCTGCAGACGGAGTCAGGT TTGAGTGAATGCCTGTTTGC Myh 2 ( MHCIIa ) GTCAAAGGAGGAGGAACAGCAGC GTTGAGTGAATGCTTGCTTCCCC Myh 4 ( MHCIIb ) TGGCCGAGCAAGAGCTAC TTGATGAGGCTGGTGTTCTG Myh 7 ( MHCI ) GCCAACTATGCTGGAGCTGATGCCC GGTGCGTGGAGCGCAAGTTTGTCATAAG Gapdh TCAACGGGAAGCCCATCA CTCGTGGTTCACACCCATCA PERM 1 D

  2015cites this paper
• Promoter-specific regulation of PPARGC1A gene expression in human skeletal muscle.

  2015cites this paper
• The hitchhiker’s guide to PGC-1α isoform structure and biological functions

  2015influential citation
• Inactivation of EWS reduces PGC-1α protein stability and mitochondrial homeostasis

  2015cites this paper
• PGC-1α concentration in skeletal muscle by exercise is controlled by PPARβ/δ through post-transcriptional mechanism: the effects of PPARβ/δ silence on PGC-1α ubiquitination and stability

  2015cites this paper
• Intercellular: local and systemic actions of skeletal muscle PGC-1s.

  2015cites this paper
• PGC 1 α − 1 Nucleosome Position and Splice Variant Expression and Cardiovascular Disease Risk in Overweight and Obese Individuals

  2015cites this paper
• Vascular endothelial growth factor B-role in metabolism, lipotoxicity and disease

  2015cites this paper
• The role of axonal transport and mitochondrial dysfunction in neurodegeneration-focusing on Huntington's disease

  2015cites this paper
• Isoform‐Specific SCFFbw7 Ubiquitination Mediates Differential Regulation of PGC‐1α

  2015cites this paper
• New insights into PGC‐1 coactivators: redefining their role in the regulation of mitochondrial function and beyond

  2015cites this paper
• PGC-1α activity in nigral dopamine neurons determines vulnerability to α-synuclein

  2015cites this paper
• PGC-1 isoforms and their target genes are expressed differently in human skeletal muscle following resistance and endurance exercise

  2015cites this paper
• Regulation of PGC-1α Isoform Expression in Skeletal Muscles

  2015cites this paper
• Peroxisome Proliferator Activated Receptor Gamma Coactivator 1 Alpha: An Emerging Target for Neuroprotection in Parkinson's Disease.

  2015cites this paper
• Molecular basis of exercise

  2015cites this paper
• THE EFFECTS OF AEROBIC EXERCISE ON HUMAN SKELETAL MUSCLE ADAPTATIONS TO RESISTANCE EXERCISE

  2014cites this paper
• The Relationship between Muscle Fiber Type-Specific PGC-1α Content and Mitochondrial Content Varies between Rodent Models and Humans

  2014cites this paper
• Transcriptional impact of dietary methionine restriction on systemic inflammation: Relevance to biomarkers of metabolic disease during aging

  2014cites this paper