Antioxidant capacity manipulation in transgenic potato tuber by changes in phenolic compounds content.

No abstract is available for this paper.

• Publication year

  2004

• Venue

  Journal of Agricultural and Food Chemistry

• Publication date

  2004-02-25

• Fields of study

  Biology, Medicine, Chemistry, Environmental Science

• Identifiers
  DOI 10.1021/JF034482KPMID 15030206
• External record

  Open on Semantic Scholar

• Source metadata

  Semantic Scholar, PubMed

• No claims are published for this paper.

• No concepts are published for this paper.

• Monitoring changes in anthocyanin and steroid alkaloid glycoside content in lines of transgenic potato plants using liquid chromatography/mass spectrometry.

  2003cited by this paper
• Reactive oxygen species produced by NADPH oxidase regulate plant cell growth

  2003cited by this paper
• 14-3-3 Protein regulation of the antioxidant capacity of transgenic potato tubers

  2002cited by this paper
• Increasing antioxidant levels in tomatoes through modification of the flavonoid biosynthetic pathway.

  2002cited by this paper
• The antioxidant activity of BHT and new phenolic compounds PYA and PPA measured by chemiluminescence.

  2001cited by this paper
• The effects of plant flavonoids on mammalian cells: implications for inflammation, heart disease, and cancer.

  2000cited by this paper
• Anthocyanin Extracts with Antioxidant and Radical Scavenging Effect

  1999cited by this paper
• Determination of anthocyanins, flavonoids and phenolic acids in potatoes. II : Wild, tuberous Solanum species

  1998cited by this paper
• Antioxidant properties of phenolic compounds

  1997cited by this paper
• Inhibition of lipid peroxidation and the active oxygen radical scavenging effect of anthocyanin pigments isolated from Phaseolus vulgaris L.

  1996cited by this paper
• Both developmental and metabolic signals activate the promoter of a class I patatin gene

  1989cited by this paper
• Metabolite levels in specific cells and subcellular compartments of plant leaves

  1989cited by this paper
• Improved method for the isolation of RNA from plant tissues.

  1987cited by this paper
• Efficient octopine Ti plasmid-derived vectors for Agrobacterium- mediated gene transfer to plants

  1985cited by this paper
• Binary Agrobacterium vectors for plant transformation.

  1984cited by this paper
• Ecological Significance of Anthocyanins in the Seed Coats of the Phaseoleae

  1966cited by this paper

• Proteomic and metabolomic insights into the impact of topping treatment on cigar tobacco

  2025cites this paper
• Mechanisms of anthocyanin-mediated salt stress alleviation and cellular homeostasis in plants

  2025cites this paper
• Genetic and Agronomic Approaches to Micronutrient Biofortification in Solanaceae Plants

  2025cites this paper
• Physiological response of tomato plants grown in saline and non-saline soils to foliar application of SiO2/TiO2 nanocomposites

  2025cites this paper
• Chalcone synthase 2 (BpCHS2), a structural gene, was activated by low temperature to promote anthocyanin synthesis in Broussonetia papyrifera to improve its cold tolerance.

  2025cites this paper
• Transcriptome Analysis Revealed that Oxalic Acid in Exogenous Licorice Root Exudates Can Stimulate the Phenylpropane Metabolic Pathway

  2024cites this paper
• АНТИОКСИДАНТНЫЕ СВОЙСТВА КЛУБНЕЙ КАРТОФЕЛЯ (SOLANUM TUBEROSUM L.) И ВЛИЯНИЕ НА НИХ ГУМИНОВЫХ ВЕЩЕСТВ

  2024cites this paper
• Antioxidants of Non-Enzymatic Nature: Their Function in Higher Plant Cells and the Ways of Boosting Their Biosynthesis

  2023cites this paper
• Genetic Channelization Mechanism of Four Chalcone Isomerase Homologous Genes for Synergistic Resistance to Fusarium wilt in Gossypium barbadense L.

  2023cites this paper
• Phenolic Compounds of the Medicinal Plants in an Anthropogenically Transformed Environment

  2023cites this paper
• Identification of miRNAs affecting anthocyanin accumulation in different varieties of potato based on transcriptome analysis

  2023cites this paper
• Improving the Growth and Bioactive Compound Production of Selected Plant Species Using Controlled Genetic and Epigenetic Manipulation

  2022cites this paper
• Advances in the application of biosynthesis and metabolic engineering of flavonoids in plants

  2022cites this paper
• Current Status and Potential of Biofortification to Enhance Crop Nutritional Quality: An Overview

  2022cites this paper
• Reactive Oxygen Species (ROS) and Reactive Nitrogen Species (RNS) in Plants– maintenance of structural individuality and functional blend

  2022cites this paper
• Reactive oxygen species and antioxidants in living systems: an integrated overview

  2022cites this paper
• Bioenergy crops as alternative feedstocks for recovery of anthocyanins: A review

  2022cites this paper
• Protective and defensive role of anthocyanins under plant abiotic and biotic stresses: An emerging application in sustainable agriculture.

  2022cites this paper
• Stress-inducible expression of chalcone isomerase2 gene improves accumulation of flavonoids and imparts enhanced abiotic stress tolerance to rice

  2021cites this paper
• BIOFORTIFICATION OF VARIOUS VEGETABLE CROPS – A REVIEW

  2021cites this paper
• OMICS approaches towards understanding plant's responses to counterattack heavy metal stress: An insight into molecular mechanisms of plant defense

  2021cites this paper
• Potato biofortification: an effective way to fight global hidden hunger

  2021cites this paper
• Biotechnological Approaches for Nutritional Improvement in Potato ( Solanum tuberosum L.)

  2021cites this paper
• Biofortification Under Climate Change: The Fight Between Quality and Quantity

  2020cites this paper
• Potato

  2020cites this paper
• Phenolics as Plant Protective Companion Against Abiotic Stress

  2020cites this paper
• Genetically Modified Plants for Nutritionally Improved Food: A Promise Kept?

  2020cites this paper
• Anthocyanins: Coloured Bioactive Compounds in Potatoes

  2020cites this paper
• Phenolics

  2020cites this paper
• The production of plant natural products beneficial to humanity by metabolic engineering

  2020cites this paper
• Review on nutritional composition of orange‐fleshed sweet potato and its role in management of vitamin A deficiency

  2019cites this paper
• In vitro release behaviour of spray dried flaxseed oil Microcapsules for application in food system

  2019cites this paper
• Importance of Biotechnology in the Development of Functional Foods in Emerging Countries

  2019cites this paper
• Oxidative Stress and Antioxidant Defense in Plants Exposed to Metal/Metalloid Toxicity

  2019cites this paper
• Oxidative Stress and Antioxidative Defense System in Plants Growing under Abiotic Stresses

  2019cites this paper
• Jujube honey induces apoptosis in human hepatocellular carcinoma HepG2 cell via DNA damage, p53 expression, and caspase activation.

  2019cites this paper
• System Biology of Metal Tolerance in Plants: An Integrated View of Genomics, Transcriptomics, Metabolomics, and Phenomics

  2019cites this paper
• Red and purple coloured potatoes as a significant antioxidant source in human nutrition - a review

  2018cites this paper
• Overexpression of Chalcone Isomerase (CHI) Increases Resistance Against Phytophthora sojae in Soybean

  2018cites this paper
• Metabolic diversity in tuber tissues of native Chiloé potatoes and commercial cultivars of Solanum tuberosum ssp. tuberosum L.

  2018cites this paper
• Looking at Flavonoid Biodiversity in Horticultural Crops: A Colored Mine with Nutritional Benefits

  2018cites this paper
• Function analysis of anthocyanidin synthase from Morus alba L. by expression in bacteria and tobacco

  2018cites this paper
• A comparative transcriptome analysis of a wild purple potato and its red mutant provides insight into the mechanism of anthocyanin transformation

  2018cites this paper
• Biofortified Crops Generated by Breeding, Agronomy, and Transgenic Approaches Are Improving Lives of Millions of People around the World

  2018cites this paper
• Flavonoid Secondary Metabolite: Biosynthesis and Role in Growth and Development in Plants

  2018cites this paper
• Biotechnological improvement of nutritional and therapeutic value of cultivated potato.

  2018cites this paper
• A MITE Insertion in the Promoter Region of Anthocyanidin Synthase from Morus alba L.

  2018cites this paper
• Quantitative trait loci affecting intensity of violet flower colour in potato

  2017influential citation
• Effect of Cooking and Reconstitution Methods on the Loss of Bioactive Compounds in Pigmented and Unpigmented Potatoes

  2017cites this paper
• Biofortification in Vegetable Crops – A Review

  2017cites this paper
• Chlorogenic acid, anthocyanin and flavan-3-ol biosynthesis in flesh and skin of Andean potato tubers (Solanum tuberosum subsp. andigena).

  2017cites this paper
• Importance of Biotechnology in the Development of Functional Foods in Emerging Countries: The Case of Chile

  2017cites this paper
• Genetic Engineering: A Possible Strategy for Protein–Energy Malnutrition Regulation

  2017cites this paper
• Promise, problems and prospects: agri-biotech governance in China, India and Japan

  2017cites this paper
• Electromagnetic Field Seems to Not Influence Transcription via CTCT Motif in Three Plant Promoters

  2017cites this paper
• Somatic cell genetics and its application in potato breeding.

  2017cites this paper
• Nutrient Biofortification of Staple Food Crops: Technologies, Products and Prospects

  2017cites this paper
• Biochemical and Phytochemical Properties of Potato : A Review

  2017cites this paper
• Metabolic Biosynthesis of Potato (Solanum tuberosum l.) Antioxidants and Implications for Human Health

  2016cites this paper
• H2O2 Improves Quality of Radix scutellariae Through Anti-oxidant Effect

  2016cites this paper
• Glucose Sensor MdHXK1 Phosphorylates and Stabilizes MdbHLH3 to Promote Anthocyanin Biosynthesis in Apple

  2016cites this paper
• A Review on Applications of Biotechnology in Textile and Medical Industry

  2016cites this paper
• Identification and quantification of anthocyanins in transgenic purple tomato.

  2016cites this paper
• Molecular Biology of Plant Natural Products

  2016cites this paper
• TTCATAGTCTCCGATACCAGATCCTG TATAAAACAGAGTGTTGCGGATCCC TAATGGGAAGGATAATCAGGATCTGG GATAGTGAATCATGGTGTTAAGCCTG GAACGCCCCTGAAGATTG ATCTTGGTGATTTGAGGA CGACACGCTACTCAACACACCACCTCGCACAGCCTCCTCAAGCGGCCGCNNNNNNGCCT CGACACGCTACTCAACAC TCAACACACCACCTCGCACAGC CATTCCCTACACGCCTCTGAT TTCATAGTCTCCGATACCAGATCCTG ATGT

  2016cites this paper
• SUCROSE METABOLISM FOR CELLULOSE BIOSYNTHESIS IN COLORED COTTON FIBERS

  2016cites this paper
• The Reaumuria trigyna leucoanthocyanidin dioxygenase (RtLDOX) gene complements anthocyanidin synthesis and increases the salt tolerance potential of a transgenic Arabidopsis LDOX mutant.

  2016cites this paper
• The Plant Natural Products: Their Antioxidants, Free Radical Scavengers, DNA Protection and Antimicrobial Activities

  2016cites this paper
• Química de los alimentos

  2016cites this paper
• Chapter 9 – Colored Potatoes

  2016cites this paper
• Over‐expression of bael quinolone synthase in tobacco improves plant vigor under favorable conditions, drought, or salt stress

  2015cites this paper
• Somatic Genome Manipulation

  2015cites this paper
• Emulsions Made of Oils from Seeds of GM Flax Protect V79 Cells against Oxidative Stress

  2015cites this paper
• Antioxidant Activity, Total Phenolic and Total Flavonoid Content in Sixty Varieties of Potato (Solanum tuberosum L.) Grown in Ireland

  2015cites this paper
• Overexpression of a tomato flavanone 3-hydroxylase-like protein gene improves chilling tolerance in tobacco.

  2015cites this paper
• Breeding Vegetables with Increased Content in Bioactive Phenolic Acids

  2015cites this paper
• Varietal dependence of chemoprotective substances in fresh and frozen spinach (Spinacia oleracea, L.)

  2015cites this paper
• Somatic Embryogenesis for Potato ( Solanum tuberosum L.) Improvement

  2015cites this paper
• Biotechnology Crop Adoption: Potential and Challenges of Genetically Improved Crops

  2014cites this paper
• Reactive Oxygen Species Generation, Hazards, and Defense Mechanisms in Plants under Environmental (Abiotic and Biotic) Stress Conditions

  2014cites this paper
• Identification and quantification of anthocyanins in the transgenic tomatoes (393.8)

  2014cites this paper
• Plant Signaling: Response to Reactive Oxygen Species

  2014cites this paper
• Plant Signalling: Response to Reactive Oxygen Species

  2014cites this paper
• Crossbreeding of transgenic flax plants overproducing flavonoids and glucosyltransferase results in progeny with improved antifungal and antioxidative properties

  2014cites this paper
• Identification and quantification of anthocyanins in the transgenic tomatoes (393.8)

  2014cites this paper
• Cloning and characterization of a potato StAN11 gene involved in anthocyanin biosynthesis regulation.

  2014cites this paper
• Transgenic potato plants with overexpression of dihydroflavonol reductase can serve as efficient nutrition sources.

  2013cites this paper
• The Arabidopsis thaliana mutant air1 implicates SOS3 in the regulation of anthocyanins under salt stress

  2013cites this paper
• Transgenic Tobacco Overexpressing Tea cDNA Encoding Dihydroflavonol 4-Reductase and Anthocyanidin Reductase Induces Early Flowering and Provides Biotic Stress Tolerance

  2013cites this paper
• THE USE OF TRANSGENIC PLANTS FOR THE DEVELOPMENT OF SELECTED BIOPRODUCTS - ACHIEVEMENTS OF THE POLISH SCIENTISTS

  2013cites this paper
• Functional Foods: Genetics, Metabolome, and Engineering Phytonutrient Levels

  2013cites this paper
• Beneficial phytochemicals in potato — a review

  2013cites this paper
• Enhancement of Natural Antioxidants in Plants by Biosynthetic Pathway Modulation

  2013cites this paper
• The changes of the polyphenol content and antioxidant activity in potato tubers (Solanum tuberosum L.) due to nitrogen fertilization.

  2013cites this paper
• Molecular Aspects of Fungal Bioactive Polyketides

  2013cites this paper
• Nutrition, Well-Being and Health

  2012cites this paper
• Optimization of extraction of phenolic acids from a vegetable waste product using a pressurized liquid extractor

  2012cites this paper
• Impact of selected factors – Cultivar, storage, cooking and baking on the content of anthocyanins in coloured-flesh potatoes

  2012cites this paper
• Physiological and biochemical dissection of fiber development in colored cotton

  2012cites this paper
• Engineering flax plants to increase their antioxidant capacity and improve oil composition and stability.

  2012cites this paper