Mapping a novel cellular‐senescence gene to human chromosome 2q37 by irradiation microcell‐mediated chromosome transfer

No abstract is available for this paper.

• Publication year

  1998

• Venue

  Molecular Carcinogenesis

• Publication date

  1998-05-01

• Fields of study

  Biology, Medicine

• Identifiers
  DOI 10.1002/(SICI)1098-2744(199805)22:1<34::AID-MC5>3.0.CO;2-LPMID 9609099
• External record

  Open on Semantic Scholar

• Source metadata

  Semantic Scholar, PubMed

• No claims are published for this paper.

• No concepts are published for this paper.

• Functional expression and germline atransmission of a human chromosome fragment in chimaeric mice

  1997cited by this paper
• Multiple pathways to cellular senescence: role of telomerase repressors.

  1997cited by this paper
• Specific cloning of human DNA as yeast artificial chromosomes by transformation-associated recombination.

  1996cited by this paper
• Localization of a tumor suppressor gene in 11p15.5 using the G401 Wilms' tumor assay.

  1996cited by this paper
• Highly selective isolation of human DNAs from rodent-human hybrid cells as circular yeast artificial chromosomes by transformation-associated recombination cloning.

  1996cited by this paper
• A Gene Map of the Human Genome

  1996cited by this paper
• Restoration of the Cellular Senescence Program and Repression of Telomerase by Human Chromosome 3

  1995cited by this paper
• Identification of a novel phospholipase C family gene at chromosome 2q33 that is homozygously deleted in human small cell lung carcinoma.

  1995cited by this paper
• Normal human chromosome 2 induces cellular senescence in the human cervical carcinoma cell line SiHa

  1995cited by this paper
• A biomarker that identifies senescent human cells in culture and in aging skin in vivo.

  1995cited by this paper
• A high-resolution cytogenetic map of human chromosome 2: localization of 434 cosmid markers by direct R-banding fluorescence in situ hybridization.

  1995cited by this paper
• Homozygous deletion at chromosome 2q33 in human small-cell lung carcinoma identified by arbitrarily primed PCR genomic fingerprinting.

  1994cited by this paper
• Report and abstracts of the Third International Workshop on Human Chromosome 2 Mapping 1994. Aarhus, Denmark, June 24-26, 1994.

  1994cited by this paper
• In vitro growth suppression and morphological change in a human renal cell carcinoma cell line by the introduction of normal chromosome 3 via microcell fusion

  1994cited by this paper
• Specific association of human telomerase activity with immortal cells and cancer.

  1994cited by this paper
• Evidence for multiple pathways to cellular senescence.

  1994cited by this paper
• Senescence of immortal human fibroblasts by the introduction of normal human chromosome 6.

  1994cited by this paper
• A gene involved in control of human cellular senescence on human chromosome 1q

  1994cited by this paper
• Report and abstracts of the Third International Workshop on Human Chromosome 2 Mapping 1994. Aarhus, Denmark, June 24-26, 1994.

  1994cited by this paper
• Chromosome 7 suppresses indefinite division of nontumorigenic immortalized human fibroblast cell lines KMST-6 and SUSM-1.

  1993cited by this paper
• Tumor cell growth arrest caused by subchromosomal transferable DNA fragments from chromosome 11

  1993cited by this paper
• Telomere length predicts replicative capacity of human fibroblasts.

  1992cited by this paper
• Report of the Fourth International Workshop on Human Chromosome 2 Mapping 1996

  1992cited by this paper
• Fluorescence in situ hybridization of YAC clones after Alu-PCR amplification.

  1992cited by this paper
• Allelotype of non-small cell lung carcinoma--comparison between loss of heterozygosity in squamous cell carcinoma and adenocarcinoma.

  1992cited by this paper
• Genetic analysis of indefinite division in human cells: evidence for a cell senescence-related gene(s) on human chromosome 4.

  1991cited by this paper
• Dinucleotide repeat polymorphism at the human preproglucagon gene.

  1991cited by this paper
• Induction of cellular senescence in immortalized cells by human chromosome 1.

  1990cited by this paper
• Irradiation microcell‐mediated chromosome transfer (XMMCT): The generation of specific chromosomal arm deletions

  1990cited by this paper
• Rapid isolation of DNA probes within specific chromosome regions by interspersed repetitive sequence polymerase chain reaction.

  1990cited by this paper
• Multiple chromosomes carrying tumor suppressor activity for a uterine endometrial carcinoma cell line identified by microcell-mediated chromosome transfer.

  1990cited by this paper
• Normal human chromosome 11 suppresses tumorigenicity of human cervical tumor cell line SiHa

  1989cited by this paper
• Genetic analysis of indefinite division in human cells: identification of four complementation groups.

  1988cited by this paper
• Suppression of tumorigenicity in somatic cell hybrids. IV. Chromosomes of normal human cells associated with suppression of tumorigenicity in hybrids with D98AH2 carcinoma cells.

  1986cited by this paper
• Loss of alleles at polymorphic loci on chromosome 2 in uveal melanoma.

  1986cited by this paper
• Evidence for the recessive nature of cellular immortality.

  1983cited by this paper
• The cell biology of human aging.

  1980cited by this paper
• Suppression of tumorigenicity in somatic cell hybrids. I. Suppression and reexpression of tumorigenicity in diploid human X D98AH2 hybrids and independent segregation of tumorigenicity from other cell phenotypes.

  1980cited by this paper
• The cell biology of human aging.

  1976cited by this paper
• Detection of specific sequences among DNA fragments separated by gel electrophoresis.

  1975cited by this paper
• Studies on a New Human Cell Line (SiHa) Derived from Carcinoma of Uterus. I. Its Establishment and Morphology 1

  1970cited by this paper

• Studies of Tumor Suppressor Genes via Chromosome Engineering

  2015cites this paper
• Minimal Peroxide Exposure of Neuronal Cells Induces Multifaceted Adaptive Responses

  2010cites this paper
• Identification of novel tumour suppressor genes involved in the development of cutaneous malignant melanoma

  2009cites this paper
• Chromosome 6 encoded RNaseT2 protein is a cell growth regulator

  2009cites this paper
• Screening for submicroscopic chromosomal rearrangements in Wilms tumor using whole-genome microarrays.

  2008cites this paper
• Transfer of human artificial chromosome vectors into stem cells.

  2008cites this paper
• Primer Sequences AATTAACCGTTTTGGTCCT GCGACACACACTTCCC GCCAGTGATGCTAAAGGTTG AACATACGTGGCTCTATGCA AAAGAGAC CTGCTAACAC CCTATGTTGGAGATGTTTAT GTCACCCAAAAGTCATGAGG TGTACCCG CATGCTATACAA GATCGTGCCACTGTACC CGCGTGTCTAACCTCATGGC GGGTTGGTTGTAAATTAAAAC TGTCAAATACTTAAGCACAG CATGTTGCCAAACACAGACC ATCCTGGCAAGACAGTT

  2007cites this paper
• Stat1 Expression Is Not Sufficient to Regulate the Interferon Signaling Pathway in Cellular Immortalization

  2006cites this paper
• Senescence and immortalization of human cells

  2004cites this paper
• Stability of transferred human chromosome fragments in cultured cells and in mice

  2004cites this paper
• Human monochromosome hybrid cell panel characterized by FISH in the JCRB/HSRRB

  2004cites this paper
• Genetic analysis identifies putative tumor suppressor sites at 2q35–q36.1 and 2q36.3–q37.1 involved in cervical cancer progression

  2003cites this paper
• The quest for a tumor suppressor gene phenotype.

  2003cites this paper
• Candidate chromosomal regions for genes involved in activation of alternative lengthening of telomeres in human immortal cell lines.

  2003cites this paper
• Identification of a ≦600-kb region on human chromosome 1q42.3 inducing cellular senescence

  2003cites this paper
• Human chromosome 5 carries a putative telomerase repressor gene

  2003cites this paper
• Genetics of Cellular Aging

  2003cites this paper
• Telomeres and Cellular Aging

  2003cites this paper
• Induction of cellular senescence in a telomerase negative human immortal fibroblast cell line, LCS-AF.1-3, by human chromosome 6.

  2002cites this paper
• Genetics of cellular senescence.

  2002cites this paper
• Loss of heterozygosity on chromosome 7q in in vitro-immortalized human oral keratinocyte cell lines.

  2002cites this paper
• Replicative senescence and senescence-like state induced in cancer-derived cells.

  2002cites this paper
• Multiple human chromosomes carrying tumor‐suppressor functions for the mouse melanoma cell line B16‐F10, identified by microcell‐mediated chromosome transfer

  2002cites this paper
• Construction of 700 human/mouse A9 monochromosomal hybrids and analysis of imprinted genes on human chromosome 6

  2001cites this paper
• Specific impairment of cardiogenesis in mouse ES cells containing a human chromosome 21.

  2000cites this paper
• Genetic approaches to the study of replicative senescence.

  2000cites this paper
• Cellular Senescence Mechanisms Independent of Telomere Shortening and Telomerase: Other Barriers to Cell Immortalization and Carcinogenesis

  2000cites this paper
• Telomere Maintenance in Telomerase-Deficient Mouse Embryonic Stem Cells: Characterization of an Amplified Telomeric DNA

  2000cites this paper
• Cloning and characterization of the promoter region of human telomerase reverse transcriptase gene.

  1999cites this paper
• Mapping of novel regions of DNA gain and loss by comparative genomic hybridization in esophageal carcinoma in the Black and Colored populations of South Africa.

  1999cites this paper
• HDAC4, a Human Histone Deacetylase Related to Yeast HDA1, Is a Transcriptional Corepressor

  1999cites this paper
• Mouse A9 cells containing single human chromosomes for analysis of genomic imprinting.

  1999cites this paper
• A reassessment of the telomere hypothesis of senescence

  1998cites this paper
• Anti-Aging Medicine LiteratureWatch

  1998cites this paper