Restoration of the Cellular Senescence Program and Repression of Telomerase by Human Chromosome 3

Telomeres, at the end of chromosomes, shorten with each cell division, resulting in cellular senescence. Tumor cells, unlike normal somatic cells, express a telomerase that maintains the telomere length. Deletion of a gene(s) on chromosome 3 is common in human renal cell carcinoma (RCC) and reintroduction of a normal chromosome 3 into an RCC immortal cell line restored the program of cellular senescence. The loss of indefinite growth potential was associated with the loss of telomerase activity and shortening of telomeres in the RCC cells with a normal chromosome 3. However, microcell hybrids that escaped from senescence and microcell hybrids with an introduced chromosome 7 or 11 maintained telomere lengths and telomerase activity similar to those of the parental RCC23. Thus, restoration of the cellular senescence program by chromosome 3 is associated with repression of telomerase function in RCC cells.

• Publication year

  1995

• Venue

  Japanese journal of cancer research : Gann

• Publication date

  1995-10-01

• Fields of study

  Biology, Medicine

• Identifiers
  DOI 10.1111/J.1349-7006.1995.TB02998.XPMID 7493906PMCID 5920601
• External record

  Open on Semantic Scholar

• Source metadata

  Semantic Scholar, PubMed

• No claims are published for this paper.

• No concepts are published for this paper.

• Spontaneous in vitro immortalization of breast epithelial cells from a patient with Li-Fraumeni syndrome

  1995cited by this paper
• Evidence for multiple pathways to cellular senescence.

  1994cited by this paper
• Senescence of immortal human fibroblasts by the introduction of normal human chromosome 6.

  1994cited by this paper
• Activation of telomerase in a human tumor.

  1994cited by this paper
• In vitro growth suppression and morphological change in a human renal cell carcinoma cell line by the introduction of normal chromosome 3 via microcell fusion

  1994cited by this paper
• Activation of telomerase in a human tumor.

  1994cited by this paper
• Chromosome 7 suppresses indefinite division of nontumorigenic immortalized human fibroblast cell lines KMST-6 and SUSM-1.

  1993cited by this paper
• Tumor cell growth arrest caused by subchromosomal transferable DNA fragments from chromosome 11

  1993cited by this paper
• Telomere end-replication problem and cell aging.

  1992cited by this paper
• The telomere hypothesis of cellular aging.

  1992cited by this paper
• Telomere shortening associated with chromosome instability is arrested in immortal cells which express telomerase activity.

  1992cited by this paper
• New insights into genetic eye disease.

  1992cited by this paper
• Telomere positional effects and the regulation of cellular senescence.

  1992cited by this paper
• Genetic analysis of indefinite division in human cells: evidence for a cell senescence-related gene(s) on human chromosome 4.

  1991cited by this paper
• Senescence of nickel-transformed cells by an X chromosome: possible epigenetic control.

  1991cited by this paper
• Structure and variability of human chromosome ends

  1990cited by this paper
• Replicative senescence: the human fibroblast comes of age.

  1990cited by this paper
• Telomeres shorten during ageing of human fibroblasts

  1990cited by this paper
• Telomeres and their synthesis.

  1990cited by this paper
• Telomeres and their synthesis.

  1990cited by this paper
• Multiple chromosomes carrying tumor suppressor activity for a uterine endometrial carcinoma cell line identified by microcell-mediated chromosome transfer.

  1990cited by this paper
• Telomeres: structure and synthesis.

  1990cited by this paper
• Induction of cellular senescence in immortalized cells by human chromosome 1.

  1990cited by this paper
• Human telomeres: fusion and interstitial sites.

  1989cited by this paper
• Genetic analysis of indefinite division in human cells: identification of four complementation groups.

  1988cited by this paper
• THE LIMITED IN VITRO LIFETIME OF HUMAN DIPLOID CELL STRAINS.

  1965cited by this paper

• Modeling specific aneuploidies: from karyotype manipulations to biological insights

  2023cites this paper
• Epigenetic and genetic inactivation of tumor suppressor miR ‐135a in non‐small‐cell lung cancer

  2023cites this paper
• Repression of hTERT transcription by the introduction of chromosome 3 into human oral squamous cell carcinoma.

  2015cites this paper
• Studies of Tumor Suppressor Genes via Chromosome Engineering

  2015cites this paper
• Investigating telomerase regulation in human breast cancer cells: a search for telomerase repressor sequences localised to chromosome 3P

  2015cites this paper
• Loss of Wild-Type ATRX Expression in Somatic Cell Hybrids Segregates with Activation of Alternative Lengthening of Telomeres

  2012cites this paper
• Cell and Molecular Aging

  2011cites this paper
• Identification of PITX1 as a TERT Suppressor Gene Located on Human Chromosome 5

  2011cites this paper
• Localization of an hTERT repressor region on human chromosome 3p21.3 using chromosome engineering

  2010cites this paper
• Human chromosome 5 carries a transcriptional regulator of human telomerase reverse transcriptase (hTERT).

  2010cites this paper
• Chromosomal and telomeric reprogramming following ES-somatic cell fusion

  2010cites this paper
• Visualization of Bonghan microcells by electron and atomic force microscopy.

  2009cites this paper
• Significance of cellular senescence in aging and cancer.

  2009cites this paper
• Telomeres and Telomerase in Humans

  2009cites this paper
• Primer Sequences AATTAACCGTTTTGGTCCT GCGACACACACTTCCC GCCAGTGATGCTAAAGGTTG AACATACGTGGCTCTATGCA AAAGAGAC CTGCTAACAC CCTATGTTGGAGATGTTTAT GTCACCCAAAAGTCATGAGG TGTACCCG CATGCTATACAA GATCGTGCCACTGTACC CGCGTGTCTAACCTCATGGC GGGTTGGTTGTAAATTAAAAC TGTCAAATACTTAAGCACAG CATGTTGCCAAACACAGACC ATCCTGGCAAGACAGTT

  2007cites this paper
• [Mechanism of cell proliferation--cell cycle, oncogenes, and senescence].

  2007cites this paper
• Human ageing and telomeres.

  2007cites this paper
• 細胞増殖のしくみ : 細胞周期，癌遺伝子，細胞老化

  2006cites this paper
• Prevalence of Fragile Histidine Triad Expression in Tumors from Saudi Arabia: A Tissue Microarray Analysis

  2006cites this paper
• A Critical Review of Telomerase Biology and Model Systems for the Study of Telomerase

  2006cites this paper
• Functional identification of a BAC clone from 16q24 carrying a senescence gene SEN16 for breast cancer cells

  2005cites this paper
• Applications of telomerase in urologic oncology

  2005cites this paper
• The manipulation of chromosomes by mankind: the uses of microcell-mediated chromosome transfer

  2005influential citation
• New Insights in Telomerase and Telomeric Proteins and Their Clinical Application to Urological Cancers

  2005cites this paper
• Diagnosis and Treatment of Human Disease Using Telomerase As a Novel Target

  2004cites this paper
• Cloning of a new familial t(3;8) translocation associated with conventional renal cell carcinoma reveals a 5 kb microdeletion and no gene involved in the rearrangement.

  2004cites this paper
• Spontaneously immortalized human T lymphocytes develop gain of chromosomal region 2p13–24 as an early and common genetic event

  2004cites this paper
• Relationship between 3p deletions and telomerase activity in non-small-cell lung cancer: prognostic implications

  2004cites this paper
• Identification of a ≦600-kb region on human chromosome 1q42.3 inducing cellular senescence

  2003cites this paper
• Human chromosome 5 carries a putative telomerase repressor gene

  2003cites this paper
• Candidate chromosomal regions for genes involved in activation of alternative lengthening of telomeres in human immortal cell lines.

  2003cites this paper
• Telomerase activity in high‐grade cervical lesions is associated with allelic imbalance at 6Q14–22

  2003cites this paper
• Telomeres and Cellular Aging

  2003cites this paper
• A mortality gene(s) for the human adenocarcinoma line HeLa maps to a 130-kb region of human chromosome 4q22-q23.

  2002cites this paper
• The significance of telomerase activation and cellular immortalization in human cancer.

  2002cites this paper
• Telomerases, telomeres, and cancer

  2002cites this paper
• Induction of cellular senescence in a telomerase negative human immortal fibroblast cell line, LCS-AF.1-3, by human chromosome 6.

  2002cites this paper
• Genetic alterations of multiple tumor suppressors and oncogenes in the carcinogenesis and progression of lung cancer

  2002cites this paper
• Molecular genetic analysis of non-familial renal cell carcinoma.

  2002cites this paper
• Telomerase as a new target for pancreatic cancer treatment.

  2002cites this paper
• Regulation of the human telomerase reverse transcriptase gene

  2002cites this paper
• Chromosome instability in human lung cancers: possible underlying mechanisms and potential consequences in the pathogenesis

  2002cites this paper
• Genetics of cellular senescence.

  2002cites this paper
• Telomerase assay in renal cancer.

  2001cites this paper
• Telomerase in urological malignancy.

  2001cites this paper
• Cell. proliferation, telomerase, and cancer

  2001cites this paper
• Telomere Position Effect in Human Cells

  2001cites this paper
• Detection of telomerase by in situ hybridization and by the polymerase chain reaction-based telomerase activity assay.

  2001cites this paper
• Molecular mechanisms regulating telomerase activity

  2001cites this paper
• Telomerase and the cell cycle

  2001cites this paper
• hTR repressor-related gene on human chromosome 10p15.1

  2001cites this paper
• Functional evidence for a telomerase repressor gene on human chromosome 10p15.1

  2001cites this paper
• PDFlib PLOP: PDF Linearization, Optimization, Protection Page inserted by evaluation version

  2001cites this paper
• Conditional immortalization of freshly isolated human mammary fibroblasts and endothelial cells.

  2001cites this paper
• hTERT expression in sporadic renal cell carcinomas

  2001cites this paper
• Telomerase suppression by chromosome 6 in a human papillomavirus type 16-immortalized keratinocyte cell line and in a cervical cancer cell line.

  2001cites this paper
• BIOLOGICAL TIMING AND THE CLOCK METAPHOR: OSCILLATORY AND HOURGLASS MECHANISMS

  2001cites this paper
• Microcell‐mediated transfer of chromosome 4 into HeLa cells suppresses telomerase activity

  2001cites this paper
• Quantum cellular biology: a curious example of a cat.

  2001cites this paper
• The role of senescence and immortalization in carcinogenesis.

  2000cites this paper
• Establishment of Novel Human Esophageal Cancer Cell Line in Relation to Telomere Dynamics and Telomerase Activity

  2000cites this paper
• G-Quadruplex DNA as a target for drug design.

  2000cites this paper
• Replicative Senescence and Oxidant‐Induced Premature Senescence: Beyond the Control of Cell Cycle Checkpoints

  2000cites this paper
• Identification of Mad as a repressor of the human telomerase (hTERT) gene

  2000cites this paper
• fhit alterations in endometrial carcinoma and hyperplasia

  2000cites this paper
• Cellular senescence of a human bladder carcinoma cell line (JTC-32) induced by a normal chromosome 11.

  2000cites this paper
• Implications of mapping the human telomerase gene (hTERT) as the most distal gene on chromosome 5p.

  2000cites this paper
• Telomerase: Therapeutic Potential in Cancer

  2000cites this paper
• Clonal Heterogeneity in Telomerase Activity and Telomere Length in Tumor-Derived Cell Lines (44505)

  2000cites this paper
• Telomerase expression in uveal melanoma

  2000cites this paper
• Molecular characteristics of eight gastric cancer cell lines established in Japan

  2000cites this paper
• Telomerase: A novel target of antitumor agents

  2000cites this paper
• Functional demonstration of a mortality phenotype associated with 4cen-q23

  2000cites this paper
• Clonal heterogeneity in telomerase activity and telomere length in tumor-derived cell lines.

  2000cites this paper
• Telomerase: therapeutic potential in cancer.

  2000cites this paper
• Characterization of a multi-tissue tumour suppressor and senescence gene.

  1999cites this paper
• Recent advances in the development of telomerase inhibitors for the treatment of cancer.

  1999cites this paper
• Telomerase‐independent senescence of human immortal cells induced by microcell‐mediated chromosome transfer

  1999cites this paper
• Closing in on another renal cancer suppressor locus near chromosome 3p14.

  1999cites this paper
• Toward identifying a cellular determinant of telomerase repression.

  1999cites this paper
• Role of telomerase in cellular proliferation and cancer

  1999cites this paper
• Effect of antisense human telomerase RNA transfection on the growth of human gastric cancer cell lines.

  1999cites this paper
• Telomerase activation in human fibroblasts during escape from crisis

  1999cites this paper
• Introduction of chromosome 7 suppresses telomerase with shortening of telomeres in a human mesothelial cell line.

  1999cites this paper
• Telomerase repressor sequences on chromosome 3 and induction of permanent growth arrest in human breast cancer cells.

  1999cites this paper
• Telomerase: A Target for Anticancer Therapy

  1999cites this paper
• Telomerase RNA expression during progression of gastric cancer.

  1999cites this paper
• Genetic changes and telomerase activity in human renal cell carcinoma.

  1999cites this paper
• Telomerase activity in hybrids between telomerase-negative and telomerase-positive immortal human cells is repressed in the different complementation groups but not in the same complementation group of immortality.

  1999cites this paper
• Gene Expression in Lung Cancer

  1999cites this paper
• Studies of the molecular mechanisms in the regulation of telomerase activity

  1999cites this paper
• Mouse A9 cells containing single human chromosomes for analysis of genomic imprinting.

  1999cites this paper
• The Wilms' Tumor 1 Tumor Suppressor Gene Represses Transcription of the Human Telomerase Reverse Transcriptase Gene*

  1999cites this paper
• Telomerase Activity in Malignant and Benign Renal Tumors

  1999cites this paper
• Mapping a novel cellular‐senescence gene to human chromosome 2q37 by irradiation microcell‐mediated chromosome transfer

  1998cites this paper
• Telomerase in tumors: facts and perspectives

  1998cites this paper
• Regulation of telomerase activity in normal and malignant human cells.

  1998cites this paper
• Cellular senescence in telomerase-expressing Syrian hamster embryo cells.

  1998cites this paper
• Ectopic Expression of wnt-5a in Human Renal Cell Carcinoma Cells Suppresses in vitro Growth and Telomerase Activity

  1998cites this paper
• Evidence for a putative telomerase repressor gene in the 3p14.2–p21.1 region

  1998cites this paper