Periplasmic interaction between two membrane regulatory proteins, ToxR and ToxS, results in signal transduction and transcriptional activation.

No abstract is available for this paper.

• Publication year

  1991

• Venue

  Cell

• Publication date

  1991-01-11

• Fields of study

  Biology, Medicine, Chemistry

• Identifiers
  DOI 10.1016/0092-8674(91)90206-EPMID 1898871
• External record

  Open on Semantic Scholar

• Source metadata

  Semantic Scholar, PubMed

• No claims are published for this paper.

• No concepts are published for this paper.

• Signal transduction by the platelet-derived growth factor receptor.

  1989cited by this paper
• Characterization of the Vibrio cholerae ToxR Regulon: Identification of Novel Genes Involved in Intestinal Colonization

  1989cited by this paper
• Identification of toxS, a regulatory gene whose product enhances toxR-mediated activation of the cholera toxin promoter

  1989influential reference
• Prokaryotic signal transduction mediated by sensor and regulator protein pairs.

  1989cited by this paper
• Signal transduction by the platelet-derived growth factor receptor.

  1988cited by this paper
• A novel suicide vector and its use in construction of insertion mutations: osmoregulation of outer membrane proteins and virulence determinants in Vibrio cholerae requires toxR

  1988cited by this paper
• Evidence that TET protein functions as a multimer in the inner membrane of Escherichia coli

  1988cited by this paper
• Growth factor receptor tyrosine kinases.

  1988cited by this paper
• Transmembrane signaling by bacterial chemoreceptors: E. coli transducers with locked signal output.

  1988cited by this paper
• An Escherichia coli mutation preventing degradation of abnormal periplasmic proteins.

  1988cited by this paper
• Transient entry of enterotoxin subunits into the periplasm occurs during their secretion from Vibrio cholerae

  1987cited by this paper
• Determinants of membrane protein topology.

  1987cited by this paper
• Use of phoA gene fusions to identify a pilus colonization factor coordinately regulated with cholera toxin.

  1987cited by this paper
• Cholera toxin transcriptional activator toxR is a transmembrane DNA binding protein.

  1987influential reference
• Genetic analysis of the cholera toxin-positive regulatory gene toxR

  1985cited by this paper
• TnphoA: a transposon probe for protein export signals.

  1985influential reference
• Experiments With Gene Fusions

  1984cited by this paper
• Synthesis of cholera toxin is positively regulated at the transcriptional level by toxR.

  1984cited by this paper
• Genetic analysis of the major outer membrane proteins of Escherichia coli.

  1981cited by this paper
• Experiments in molecular genetics

  1972cited by this paper
• Formation of a defective alkaline phosphatase subunit by a mutant of Escherichia coli.

  1967cited by this paper

• Crystal structure of the V. parahaemolyticus ToxS dimer suggests a model for bile-induced ToxRS activation

  2026cites this paper
• Allelic variations and gene cluster modularity act as nonlinear bottlenecks for cholera emergence

  2025cites this paper
• Transcriptional regulator MarT negatively regulates MarT-regulated motility gene I, a new gene involved in invasion and virulence of Salmonella enterica

  2024cites this paper
• Vibrio cholerae CsrA controls ToxR levels by increasing the stability and translation of toxR mRNA

  2024cites this paper
• Vibrio cholerae virulence and its suppression through the quorum-sensing system

  2024cites this paper
• An essential host dietary fatty acid promotes TcpH inhibition of TcpP proteolysis promoting virulence gene expression in Vibrio cholerae

  2024cites this paper
• Cholera Dynamics and the Emergence of Pandemic Vibrio cholerae.

  2023cites this paper
• ToxR activates the Vibrio cholerae virulence genes by tethering DNA to the membrane through versatile binding to multiple sites

  2023cites this paper
• Transmembrane Transcription Regulators Are Widespread in Bacteria and Archaea

  2023cites this paper
• Iron-Fur complex suppresses the expression of components of the cyclo-(Phe-Pro)-signaling regulatory pathway in Vibrio vulnificus

  2023cites this paper
• Membrane-localized expression, production and assembly of Vibrio parahaemolyticus T3SS2 provides evidence for transertion

  2023cites this paper
• Structural Insights into Regulation of Vibrio Virulence Gene Networks.

  2023cites this paper
• Co-component signal transduction systems: Fast-evolving virulence regulation cassettes discovered in enteric bacteria

  2022cites this paper
• An essential host dietary fatty acid stimulates TcpH inhibition of TcpP proteolysis enabling virulence gene expression in Vibrio cholerae

  2022cites this paper
• ToxR modulates biofilm formation in fish pathogen Vibrio harveyi

  2021cites this paper
• The Interface of Vibrio cholerae and the Gut Microbiome

  2021cites this paper
• Bile Salts Promote ToxR Regulon Activation during Growth under Virulence-Inducing Conditions

  2021cites this paper
• Coral mucus rapidly induces chemokinesis and genome-wide transcriptional shifts toward early pathogenesis in a bacterial coral pathogen

  2021cites this paper
• A disulfide constrains the ToxR periplasmic domain structure, altering its interactions with ToxS and bile-salts

  2020cites this paper
• Host stimuli and operator binding sites controlling protein interactions between virulence master regulator ToxR and ToxS in Vibrio cholerae

  2020cites this paper
• Pathogenicity and virulence regulation of Vibrio cholerae at the interface of host-gut microbiome interactions

  2020cites this paper
• A Membrane-Bound Transcription Factor is Proteolytically Regulated by the AAA+ Protease FtsH in Staphylococcus aureus

  2020cites this paper
• A vibriosis outbreak in the Pacific white shrimp, Litopenaeus vannamei reared in biofloc and clear seawater.

  2019cites this paper
• Temperature Control of psaA Expression by PsaE and PsaF in Yersinia pestis

  2019cites this paper
• The wing of the ToxR winged helix-turn-helix domain is required for DNA binding and activation of toxT and ompU

  2019cites this paper
• Advances on Vibrio parahaemolyticus research in the postgenomic era

  2019cites this paper
• Regulated Proteolysis in Vibrio cholerae Allowing Rapid Adaptation to Stress Conditions

  2019cites this paper
• Indole Inhibits ToxR Regulon Expression in Vibrio cholerae

  2019influential citation
• Regulatory Hierarchies Controlling Virulence Gene Expression in Shigella flexneri and Vibrio cholerae

  2018cites this paper
• Environmental Role of Pathogenic Traits in Vibrio cholerae

  2018cites this paper
• Proteolysis of ToxR is controlled by cysteine‐thiol redox state and bile salts in Vibrio cholerae

  2018cites this paper
• Structure-function analysis of the DNA-binding domain of a transmembrane transcriptional activator

  2017cites this paper
• A new class of inhibitors of the AraC family virulence regulator Vibrio cholerae ToxT

  2017cites this paper
• Adaptations of Cold- and Pressure-Loving Bacteria to the Deep-Sea Environment: Cell Envelope and Flagella

  2017cites this paper
• Role of the toxR Gene from Fish Pathogen Vibiro alginolyticus in the Physiology and Virulence

  2017cites this paper
• Vibrio parahaemolyticus VtrA is a membrane-bound regulator and is activated via oligomerization

  2017cites this paper
• Bile salts and alkaline pH reciprocally modulate the interaction between the periplasmic domains of Vibrio cholerae ToxR and ToxS

  2017cites this paper
• Cholera Toxin Production Induced upon Anaerobic Respiration is Suppressed by Glucose Fermentation in Vibrio cholerae.

  2016cites this paper
• Role of ToxS in the proteolytic cascade of virulence regulator ToxR in Vibrio cholerae

  2015influential citation
• Meddling Vibrio cholerae Murmurs: A Neoteric Advancement in Cholera Research

  2015cites this paper
• Coordination of Bacterial Virulence Gene Expression

  2015cites this paper
• Formation of an Intramolecular Periplasmic Disulfide Bond in TcpP Protects TcpP and TcpH from Degradation in Vibrio cholerae

  2015cites this paper
• Species diversity, spatial distribution, and virulence associated genes of culturable vibrios in a brackish coastal Mediterranean environment

  2015cites this paper
• Proteolysis of Virulence Regulator ToxR Is Associated with Entry of Vibrio cholerae into a Dormant State

  2015cites this paper
• Vibrio cholerae porin OmpU induces LPS tolerance by attenuating TLR-mediated signaling.

  2015cites this paper
• Regulated intramembrane proteolysis of the virulence activator TcpP in Vibrio cholerae is initiated by the tail‐specific protease (Tsp)

  2015cites this paper
• Vibrio cholerae CsrA Regulates ToxR Levels in Response to Amino Acids and Is Essential for Virulence

  2015cites this paper
• Chapter 60 – Vibrio cholerae

  2015cites this paper
• The Cpx System Regulates Virulence Gene Expression in Vibrio cholerae

  2015cites this paper
• Vibrio cholerae leuO Transcription Is Positively Regulated by ToxR and Contributes to Bile Resistance

  2015cites this paper
• Regulation of natural competence by the orphan two‐component system sensor kinase ChiS involves a non‐canonical transmembrane regulator in Vibrio cholerae

  2014influential citation
• Cholera and Drinking Water

  2014cites this paper
• Genome-wide phylogenetic analysis of the pathogenic potential of Vibrio furnissii

  2014cites this paper
• Genetic basis for the virulence of enterohemorrhagic Escherichia coli strain TW14359

  2014cites this paper
• The Vibrio cholerae Cpx Envelope Stress Response Senses and Mediates Adaptation to Low Iron

  2014cites this paper
• Mapping, Tracking and Modeling the Movements of Single Membrane-Bound Transcription Activator Proteins in Live Vibrio cholerae.

  2014influential citation
• Efficient responses to host and bacterial signals during Vibrio cholerae colonization

  2014cites this paper
• Interactions des protéines du complexe de transduction du signal transmembranaire CnrYXH chez Cupriavidus metallidurans CH34

  2014cites this paper
• Creation of a viable csrA mutant in Vibrio cholerae

  2013cites this paper
• Membrane Proteins

  2013cites this paper
• Genetic systems for monitoring interactions of transmembrane domains in bacterial membranes.

  2013cites this paper
• Toxin and Virulence Regulation in Vibrio cholerae

  2013cites this paper
• Functional Characterization Of The Cholera Toxin Promoter Of vibrio Cholerae

  2013cites this paper
• The transcriptional landscape of the deep-sea bacterium Photobacterium profundum in both a toxR mutant and its parental strain

  2012cites this paper
• Disulfide Bond Formation and ToxR Activity in Vibrio cholerae

  2012cites this paper
• Non-coding sRNAs regulate virulence in the bacterial pathogen Vibrio cholerae

  2012cites this paper
• Neglected but amazingly diverse type IVb pili.

  2012cites this paper
• Comparison of 16SrDNA and toxR genes as targets for detection of Vibrio anguillarum in Dicentrarchus labrax kidney and liver.

  2011cites this paper
• Isolation and sequence analysis of the full-length toxR gene of type strain Vibrio campbellii and use of the toxR gene sequence to evaluate variation and relatedness with other Vibrio species

  2011cites this paper
• Reductionistic and Holistic Science

  2011cites this paper
• primer name sequence 5’ to 3’ purpose 5’ ToxR-HA gggggatcctcaaaagagatatcgatgag cloning toxR into pcDNA-HA and pSK Bluescript 3’ ToxR-HA ggggggctcgagctcacacactttgatggc cloning toxR into pcDNA-HA 3’ HA-tag ApaI cctgacgggcccactagcgaattcatctagaagcg cloning toxR into pSK Bluescript toxR K85R TOP catttcga

  2011influential citation
• Effects of Amino Acid Supplementation on Porin Expression and ToxR Levels in Vibrio cholerae

  2011cites this paper
• Analysis of the streptococcal CpsA protein in DNA-binding and regulation of capsule and cell wall maintenance

  2011cites this paper
• Reductionistic and Holistic Science (cid:1)

  2011cites this paper
• Covert Operations: the Adaptable Plan of Attack Deployed by Pathogenic Bacteria

  2011cites this paper
• The two faces of ToxR: activator of ompU, co‐regulator of toxT in Vibrio cholerae

  2011cites this paper
• Conventional PCR assays for the detection of pathogenic Vibrio spp. in shrimp aquaculture in the Philippines.

  2011cites this paper
• Modulation of Responses of Vibrio parahaemolyticus O3:K6 to pH and Temperature Stresses by Growth at Different Salt Concentrations

  2010cites this paper
• Growth of Vibrio parahaemolyticus O 3 : K 6 at Different Salt 4 Concentrations Modulates Responses to pH and Temperature 5 Stresses 6 7 8

  2010cites this paper
• Membrane Topology and DNA-Binding Ability of the Streptococcal CpsA Protein

  2010cites this paper
• Post-transcriptional regulation of vibrio cholerae virulence activator toxt

  2010cites this paper
• Role of Cyclic Di-GMP in Vibrio cholerae Virulence

  2010cites this paper
• Identification of a regulatory cascade controlling Type III Secretion System 3 gene expression in Burkholderia pseudomallei

  2010influential citation
• Influence of environmental stress on virulence gene expression in Vibrio anguillarum

  2010cites this paper
• High pressure modulation of ToxR mediated signal transduction

  2009influential citation
• Chapter 45 – Cholera

  2009cites this paper
• Direct Regulation by the Vibrio cholerae Regulator ToxT To Modulate Colonization and Anticolonization Pilus Expression

  2009cites this paper
• Genetic tools to study gene expression during bacterial pathogen infection.

  2009cites this paper
• Direct stimulus perception and transcription activation by a membrane‐bound DNA binding protein

  2009cites this paper
• Regulation des Säure-induzierten Cad-Systems von Escherichia coli durch den membranintegrierten Transkriptionsaktivator CadC und die Lysin-spezifische Permease LysP

  2008cites this paper
• Distribution of five vibrio virulence-related genes among Vibrio harveyi isolates.

  2008cites this paper
• A Regulatory Network Controls Expression of the In Vivo-Expressed HreP Protease of Yersinia enterocolitica

  2008influential citation
• Regulation of biofilm formation and outer membrane protein expression in Vibrio cholerae by iron

  2008cites this paper
• Effects of Vibrio cholerae protease and pigment production on environmental survival and host interaction

  2007cites this paper
• Regulatory Networks Controlling Vibrio cholerae Virulence Gene Expression

  2007cites this paper
• Regulation of Vibrio Polysaccharide Synthesis and Virulence Factor Production by CdgC, a GGDEF-EAL Domain Protein, in Vibrio cholerae

  2007cites this paper
• A global gene evolution analysis on Vibrionaceae family using phylogenetic profile

  2007cites this paper
• Regulation of virulence in Vibrio cholerae: the ToxR regulon.

  2007cites this paper
• Identification of an aerotaxis transducer in Vibrio cholerae

  2007cites this paper
• Regulation of Rugosity and Biofilm Formation in Vibrio cholerae: Comparison of VpsT and VpsR Regulons and Epistasis Analysis of vpsT, vpsR, and hapR

  2007cites this paper