Acute osmotic/stress stimuli induce a transient decrease of transcriptional activity in the neurosecretory neurons of supraoptic nuclei

No abstract is available for this paper.

• Publication year

  1998

• Venue

  Journal of Neurocytology

• Publication date

  1998-04-01

• Fields of study

  Biology, Medicine

• Identifiers
  DOI 10.1023/A:1006937032068PMID 10640180
• External record

  Open on Semantic Scholar

• Source metadata

  Semantic Scholar, PubMed

• No claims are published for this paper.

• No concepts are published for this paper.

• The “accessory body” of Cajal in the neuronal nucleus

  2004cited by this paper
• Function-related plasticity in hypothalamus.

  1997cited by this paper
• Semithin cryosections as a tool to perform high resolution immunofluorescence and in situ hybridization analysis of the nervous tissue: a study in the supraoptic nucleus.

  1997cited by this paper
• Fos and Jun expression in rat supraoptic nucleus neurons after acute vs. repeated osmotic stimulation.

  1997cited by this paper
• Changes in Morphology and Spatial Position of Coiled Bodies during NGF-induced Neuronal Differentiation of PC12 Cells

  1997cited by this paper
• The dynamics of coiled bodies in the nucleus of adenovirus-infected cells.

  1996cited by this paper
• AP-1 DNA binding activity induced by hyperosmolality in the rat hypothalamic supraoptic and paraventricular nuclei.

  1996cited by this paper
• Neuronal Differentiation in the Rat Hippocampus Involves a Stage‐specific Reorganization of Subnuclear Structure both In Vivo and In Vitro

  1996cited by this paper
• Differential responses of oxytocin and vasopressin neurons to the osmotic and stressful components of hypertonic saline injections: a Fos protein double labeling study.

  1996cited by this paper
• Dispersion and culture of magnocellular neurons from the supraoptic nucleus of the adult rat.

  1996cited by this paper
• Expression of histone H1° in transcriptionally activated supraoptic neurons

  1995cited by this paper
• Mutational analysis of p80 coilin indicates a functional interaction between coiled bodies and the nucleolus

  1995cited by this paper
• Molecular analysis of the coiled body

  1995cited by this paper
• Expression of histone H1 (zero) in transcriptionally activated supraoptic neurons.

  1995cited by this paper
• The biogenesis of the coiled body during early mouse development.

  1995cited by this paper
• Formation of nuclear bodies in hepatocytes of estrogen-treated roosters.

  1995cited by this paper
• Proto-oncogene c-fos and the regulation of vasopressin gene expression during dehydration.

  1994cited by this paper
• Ultrastructural evidence of sexual dimorphism in supraoptic neurons: a morphometric study

  1993cited by this paper
• Assembly of snRNP-containing coiled bodies is regulated in interphase and mitosis--evidence that the coiled body is a kinetic nuclear structure

  1993cited by this paper
• Nuclear compartmentalization in transcriptionally activated hypothalamic neurons

  1993cited by this paper
• Macromolecular domains within the cell nucleus.

  1993cited by this paper
• The coiled body.

  1993cited by this paper
• Transcription-dependent colocalization of the U1, U2, U4/U6, and U5 snRNPs in coiled bodies

  1992cited by this paper
• Differences in snRNP localization between transformed and nontransformed cells.

  1992cited by this paper
• Rapid morphological changes in supraoptic nucleus and posterior pituitary induced by a single hypertonic saline injection.

  1992cited by this paper
• Human autoantibody to a novel protein of the nuclear coiled body: immunological characterization and cDNA cloning of p80-coilin

  1991cited by this paper
• In situ hybridization analysis of arginine vasopressin gene transcription using intron-specific probes.

  1991cited by this paper
• Evolutionary conservation of the human nucleolar protein fibrillarin and its functional expression in yeast

  1991cited by this paper
• Organization of nucleoli and nuclear bodies in osmotically stimulated supraoptic neurons of the rat

  1991cited by this paper
• c-fos mRNA, Fos, and Fos-related antigen induction by hypertonic saline and stress

  1991cited by this paper
• The regulation and function of c-fos and other immediate early genes in the nervous system.

  1990cited by this paper
• Sequence analysis of the promoter region of the rat vasopressin gene

  1990cited by this paper
• The expression of c-fos, c-jun, and c-myc genes is regulated by heat shock in human lymphoid cells.

  1990cited by this paper
• Expression of c-Fos immunoreactivity in transmitter-characterized neurons after stress.

  1989cited by this paper
• Multiple Synapse Formation: A Possible Compensatory Mechanism for Increased Cell Size in Rat Supraoptic Nucleus

  1989cited by this paper
• Mapping of B cell epitopes on small nuclear ribonucleoproteins that react with human autoantibodies as well as with experimentally-induced mouse monoclonal antibodies.

  1989cited by this paper
• c-fos mRNA levels are increased by the cellular stressors, heat shock and sodium arsenite.

  1988cited by this paper
• c-fos mRNA levels are increased by the cellular stressors, heat shock and sodium arsenite.

  1988cited by this paper
• The heat shock response in HeLa cells is accompanied by elevated expression of the c-fos proto-oncogene

  1987cited by this paper
• Vasopressin mRNA regulation in individual hypothalamic nuclei: a northern and in situ hybridization analysis

  1986cited by this paper
• The heat-shock response.

  1986cited by this paper
• Golgi apparatus, GERL, and secretory granule formation within neurons of the hypothalamo-neurohypophysial system of control and hyperosmotically stressed mice

  1981cited by this paper
• Immunohistochemical analysis of magnocellular elements in rat hypothalamus: Distribution and numbers of cells containing neurophysin, oxytocin, and vasopressin

  1981cited by this paper
• Fine structural organization of the interphase nucleus in some mammalian cells.

  1969cited by this paper
• The paranucleolar structure, accessory body of cajal, sex chromatin, and related structures in nuclei of rat trigeminal neurons: A cytochemical and ultrastructural study

  1969cited by this paper

• Identification of Fibrillarin and Cajal Bodies Under DNA Replication Stress Conditions in Root Meristem Cells of Allium cepa

  2025cites this paper
• Neuronal activation affects the organization and protein composition of the nuclear speckles

  2024cites this paper
• Coilin and Cajal bodies

  2023cites this paper
• Anatomical Markers of Activity in Hypothalamic Neurons.

  2020cites this paper
• Spatial control of neuronal metabolism through glucose-mediated mitochondrial transport regulation

  2018cites this paper
• TDRD6 mediates early steps of spliceosome maturation in primary spermatocytes

  2017cites this paper
• RNA modification in Cajal bodies

  2017cites this paper
• Heterogeneity of coilin-containing nuclear domains in early mouse embryos

  2017cites this paper
• Cellular bases of the RNA metabolism dysfunction in motor neurons of a murine model of spinal muscular atrophy: Role of Cajal bodies and the nucleolus.

  2017cites this paper
• Cajal bodies in neurons

  2017influential citation
• Novel intrathecal and subcutaneous catheter delivery systems in the mouse.

  2016cites this paper
• Expression pattern of NeuN and GFAP during human fetal spinal cord development

  2015cites this paper
• Respuesta de las neuronas sensitivas al estrés genotóxico inducido por radiaciones ionizantes y por la inhibición del proteasoma

  2014cites this paper
• Reactive nucleolar and Cajal body responses to proteasome inhibition in sensory ganglion neurons.

  2014cites this paper
• Intranuclear Rodlets: Dynamic Nuclear Bodies in Pancreatic Beta-Cells; and, A Novel Variant in Mouse CNS Neurons.

  2013cites this paper
• Estrogenic regulation of NADPH-diaphorase in the supraoptic and paraventricular nuclei under acute osmotic stress.

  2013cites this paper
• Reorganization of Cajal bodies and nucleolar targeting of coilin in motor neurons of type I spinal muscular atrophy

  2012cites this paper
• ACCACTTTGTACAAGAAAGCTGGGT 4 forward GGGGACAAGTTTGTACAAAAAAGCAGGCTTCACCATGCTGCGCCTCTCCGAACG 4 reverse GGGGACCACTTTGTACAAGAAAGCTGGGTTCTACTCCTTGGCGATGGCAA 5 reverse GGGGACCACTTTGTACAAGAAAGCTGGGTGCTCCTTGGCGATGGCAAAGG 6 forward GGGGACAAGTTTGTACAAAAAAGCAGGCTTCACCATGGATGAGAAGAAGAA 7 reverse GGGGACCACTTTGTA

  2012cites this paper
• Spatiotemporal behavior of nuclear cyclophilin B indicates a role in RNA transcription.

  2012cites this paper
• Nucleolar Disruption and Cajal Body Disassembly are Nuclear Hallmarks of DNA Damage‐Induced Neurodegeneration in Purkinje Cells

  2011cites this paper
• In vivo kinetics of U4/U6·U5 tri-snRNP formation in Cajal bodies

  2011cites this paper
• A change of developmental program induces the remodeling of the interchromatin domain during microspore embryogenesis in Brassica napus L.

  2011cites this paper
• Nucleolar targeting of coilin is regulated by its hypomethylation state

  2010cites this paper
• Subpallial and hypothalamic areas activated following sexual and agonistic encounters in male chickens.

  2010cites this paper
• Spinal muscular atrophy: molecular mechanisms.

  2009cites this paper
• Cajal’s contribution to the knowledge of the neuronal cell nucleus

  2009cites this paper
• SUMO-1 transiently localizes to Cajal bodies in mammalian neurons.

  2008cites this paper
• Nuclear compartmentalization and dynamics of the poly(A)-binding protein nuclear 1 (PABPN1) inclusions in supraoptic neurons under physiological and osmotic stress conditions.

  2008cites this paper
• The Cajal body.

  2008cites this paper
• Cajal body number and nucleolar size correlate with the cell body mass in human sensory ganglia neurons.

  2007cites this paper
• Nuclear organization and dynamics of transcription sites in rat sensory ganglia neurons detected by incorporation of 5'-fluorouridine into nascent RNA.

  2006cites this paper
• Ultrastructural and molecular characterisation of the neuronal nucleus.

  2006influential citation
• Pre-neurodegeneration of mitral cells in the pcd mutant mouse is associated with DNA damage, transcriptional repression, and reorganization of nuclear speckles and Cajal bodies.

  2006influential citation
• Nuclear bodies domain changes with microspore reprogramming to embryogenesis.

  2006influential citation
• Differentiating plant cells switched to proliferation remodel the functional organization of nuclear domains

  2005cites this paper
• Reorganization of nuclear compartments of type A neurons of trigeminal ganglia in response to inflammatory injury of peripheral nerve endings

  2004cites this paper
• PML bodies in reactive sensory ganglion neurons of the Guillain-Barré syndrome.

  2004cites this paper
• Targeting SMN to Cajal bodies and nuclear gems during neuritogenesis

  2004cites this paper
• Effects of glucagon-like peptide-1 (7-36) amide on neurohypophysial hormone secretion induced by acute hyperosmotic challenge.

  2003cites this paper
• Dynamic association of RNA-editing enzymes with the nucleolus

  2003cites this paper
• Clastosome: a subtype of nuclear body enriched in 19S and 20S proteasomes, ubiquitin, and protein substrates of proteasome.

  2002influential citation
• cAMP-Dependen tReorganizatio nof th eCaja lBodie san dSplicing Machiner yi nCulture dSchwan nCells

  2002cites this paper
• Transcriptional responses of the rat vasopressin gene to acute and repeated acute osmotic stress.

  2002cites this paper
• Alcohol differentially affects c-Fos expression in the supraoptic nucleus of long-sleep and short-sleep mice.

  2002cites this paper
• Large-scale isolation of Cajal bodies from HeLa cells.

  2002cites this paper
• Structural and functional compartmentalization of the cell nucleus in supraoptic neurons

  2002influential citation
• Cleared extrachromosomal domain (CED): a nuclear domain enriched in nuclear matrix filaments is a common structure in sturgeon podocytes

  2002cites this paper
• cAMP‐dependent reorganization of the Cajal bodies and splicing machinery in cultured Schwann cells

  2002cites this paper
• Central galanin and N-terminal galanin fragment induce c-Fos immunoreactivity in the medulla oblongata of the anesthetized rat.

  2001cites this paper
• Nuclear gems and Cajal (coiled) bodies in fetal tissues: nucleolar distribution of the spinal muscular atrophy protein, SMN.

  2001cites this paper
• Space flight affects magnocellular supraoptic neurons of young prepuberal rats: transient and permanent effects.

  2001cites this paper
• Neuronal body size correlates with the number of nucleoli and Cajal bodies, and with the organization of the splicing machinery in rat trigeminal ganglion neurons

  2001influential citation
• Characterisation of transcriptionally active and inactive chromatin domains in neurons.

  2000cites this paper
• Cajal bodies: the first 100 years.

  2000cites this paper
• The Spinal Muscular Atrophy Disease Gene Product, Smn

  1999influential citation
• Nuclear organization of pre-mRNA splicing factors.

  1999cites this paper