Expression of cytochromes P450 1A1 and 1B1 in human lung from smokers, non-smokers, and ex-smokers.

No abstract is available for this paper.

• Publication year

  2004

• Venue

  Toxicology and Applied Pharmacology

• Publication date

  2004-09-15

• Fields of study

  Medicine, Chemistry, Environmental Science

• Identifiers
  DOI 10.1016/J.TAAP.2003.11.015PMID 15364538
• External record

  Open on Semantic Scholar

• Source metadata

  Semantic Scholar, PubMed

• No claims are published for this paper.

• No concepts are published for this paper.

• Monooxygenase activities of human liver, lung, and kidney microsomes - a study of 42 post mortem cases.

  2009cited by this paper
• Immunohistochemical localization of cytochrome P450 3A in human pulmonary carcinomas and normal bronchial tissue

  2005cited by this paper
• Cotinine levels and self-reported smoking status in patients attending a bronchoscopy clinic

  2003cited by this paper
• CYP1B1 expression in human lung.

  2001cited by this paper
• CYP1A2 is expressed along with CYP1A1 in the human lung.

  2001cited by this paper
• In Situ Hybridization and Immunohistochemical Analysis of Cytochrome P450 1B1 Expression in Human Normal Tissues

  2001cited by this paper
• Expression of CYP1A1, CYP1B1 and CYP3A, and polycyclic aromatic hydrocarbon‐DNA adduct formation in bronchoalveolar macrophages of smokers and non‐smokers

  2000cited by this paper
• Induction of cytochrome P4501A1.

  1999cited by this paper
• Characterization of the dose-response of CYP1B1, CYP1A1, and CYP1A2 in the liver of female Sprague-Dawley rats following chronic exposure to 2,3,7,8-tetrachlorodibenzo-p-dioxin.

  1999cited by this paper
• Cytochrome P450 CYP1B1 determines susceptibility to 7, 12-dimethylbenz[a]anthracene-induced lymphomas.

  1999cited by this paper
• Genetic epidemiology of environmental toxicity and cancer susceptibility: human allelic polymorphisms in drug-metabolizing enzyme genes, their functional importance, and nomenclature issues.

  1999cited by this paper
• Induction and localization of cytochrome P450 1B1 (CYP1B1) protein in the livers of TCDD-treated rats: detection using polyclonal antibodies raised to histidine-tagged fusion proteins produced and purified from bacteria.

  1998cited by this paper
• Stable expression of human cytochrome P450 1B1 in V79 Chinese hamster cells and metabolically catalyzed DNA adduct formation of dibenzo[a,l]pyrene.

  1998cited by this paper
• Metabolism of benzo[a]pyrene and benzo[a]pyrene-7,8-diol by human cytochrome P450 1B1.

  1998cited by this paper
• Localization of CYP1A1 mRNA in human lung by in situ hybridization: Comparison with immunohistochemical findings

  1998cited by this paper
• Expression of CYP1B1 in human adult and fetal tissues and differential inducibility of CYP1B1 and CYP1A1 by Ah receptor ligands in human placenta and cultured cells.

  1997cited by this paper
• Quantitative RT-PCR measurement of cytochromes p450 1A1, 1B1, and 2B7, microsomal epoxide hydrolase, and NADPH oxidoreductase expression in lung cells of smokers and nonsmokers.

  1997cited by this paper
• Induction of cytochrome P450 1B1 and catechol estrogen metabolism in ACHN human renal adenocarcinoma cells.

  1997cited by this paper
• Expression and localization of CYP3A4 and CYP3A5 in human lung.

  1997cited by this paper
• Human cytochrome P450 enzymes: a status report summarizing their reactions, substrates, inducers, and inhibitors.

  1997cited by this paper
• Evidence for CYP2D6 expression in human lung.

  1997cited by this paper
• Analysis of CYP2D6 expression in human lung: implications for the association between CYP2D6 activity and susceptibility to lung cancer.

  1997cited by this paper
• Tumor-specific expression of cytochrome P450 CYP1B1.

  1997cited by this paper
• Isolation and Characterization of the Human Cytochrome P450 CYP1B1 Gene*

  1996cited by this paper
• Induction of cytochrome P4501A1: a model for analyzing mammalian gene transcription

  1996cited by this paper
• Activation of chemically diverse procarcinogens by human cytochrome P-450 1B1.

  1996cited by this paper
• 17 beta-estradiol hydroxylation catalyzed by human cytochrome P450 1B1.

  1996cited by this paper
• Contribution of human cytochrome P450 to benzo[a]pyrene and benzo[a]pyrene-7,8-dihydrodiol metabolism, as predicted from heterologous expression in yeast.

  1996cited by this paper
• Lung cancer : principles and practice

  1996cited by this paper
• Characterization of microsomal cytochrome P450 enzymes involved in the oxidation of xenobiotic chemicals in human fetal liver and adult lungs.

  1996cited by this paper
• Oxidation of benzo[a]pyrene by recombinant human cytochrome P450 enzymes.

  1995cited by this paper
• The aryl hydrocarbon receptor complex.

  1995cited by this paper
• Interindividual variations in human liver cytochrome P-450 enzymes involved in the oxidation of drugs, carcinogens and toxic chemicals: studies with liver microsomes of 30 Japanese and 30 Caucasians.

  1994cited by this paper
• Complete cDNA sequence of a human dioxin-inducible mRNA identifies a new gene subfamily of cytochrome P450 that maps to chromosome 2.

  1994cited by this paper
• Studies on the metabolism of benzo[a]pyrene and dose-dependent differences in the mutagenic profile of its ultimate carcinogenic metabolite.

  1994cited by this paper
• Genetic susceptibility to lung cancer with special emphasis on CYP1A1 and GSTM1: a study on host factors in relation to age at onset, gender and histological cancer types.

  1994cited by this paper
• Quantification of CYP2B7, CYP4B1, and CYPOR messenger RNAs in normal human lung and lung tumors.

  1994cited by this paper
• The role of 12 cDNA‐expressed human, rodent, and rabbit cytochromes P450 in the metabolism of benzo[a]pyrene and benzo[a]pyrene trans‐7, 8‐dihydrodiol

  1994cited by this paper
• The AH-receptor: genetics, structure and function.

  1993cited by this paper
• The epidemiology of lung cancer.

  1993cited by this paper
• Polycyclic aromatic hydrocarbon metabolism in rat adrenal, ovary, and testis microsomes is catalyzed by the same novel cytochrome P450 (P450RAP).

  1992cited by this paper
• Stereoselective metabolism of (-)-benzo[a]pyrene-7,8-diol by human lung microsomes and peripheral blood lymphocytes: effect of smoking.

  1992cited by this paper
• Immunohistochemical detection of pulmonary cytochrome P450IA and metabolic activities associated with P450IA1 and P450IA2 isozymes in lung cancer patients.

  1992cited by this paper
• Characterization of human lung microsomal cytochrome P-450 1A1 and its role in the oxidation of chemical carcinogens.

  1992cited by this paper
• Cytochrome P-450-dependent metabolism of xenobiotics in human lung.

  1991cited by this paper
• Targets for dioxin: genes for plasminogen activator inhibitor-2 and interleukin-1 beta.

  1991cited by this paper
• Molecular epidemiology and the genetics of environmental cancer.

  1991cited by this paper
• Role of genetics and drug metabolism in human cancer risk.

  1991cited by this paper
• Human AH locus polymorphism and cancer: inducibility of CYP1A1 and other genes by combustion products and dioxin.

  1991cited by this paper
• Comparative dose-response tumorigenicity studies of dibenzo[alpha,l]pyrene versus 7,12-dimethylbenz[alpha]anthracene, benzo[alpha]pyrene and two dibenzo[alpha,l]pyrene dihydrodiols in mouse skin and rat mammary gland.

  1991cited by this paper
• Smoking and peripheral type of cancer are related to high levels of pulmonary cytochrome P450IA in lung cancer patients

  1991cited by this paper
• The Ah receptor and the mechanism of dioxin toxicity.

  1991cited by this paper
• Comparative dose-response tumorigenicity studies of dibenzo[a,l]pyrene versus 7, 12-dimethylbenz[a]anthracene, benzo[a and two dibenzo[a,l]pyrene dihydrodiols in mouse skin and rat mammary gland

  1991cited by this paper
• Expression of CYP1A1 gene in patients with lung cancer: evidence for cigarette smoke-induced gene expression in normal lung tissue and for altered gene regulation in primary pulmonary carcinomas.

  1990cited by this paper
• Enzyme induction in the cytochrome P-450 system.

  1990cited by this paper
• Purification and characterization of xenobiotic-metabolizing enzymes from lung tissue.

  1990cited by this paper
• Immunochemical analysis of a cytochrome P-450IA1 homologue in human lung microsomes.

  1990cited by this paper
• Statistical Power Analysis for the Behavioral Sciences (2nd ed.)

  1989cited by this paper
• The control of cytochrome P-450 gene expression by dioxin.

  1989cited by this paper
• Xenobiotic metabolism by isolated pulmonary cells.

  1989cited by this paper
• Aryl hydrocarbon hydroxylase in lymphocytes and lung tissue from lung cancer patients and controls

  1987cited by this paper
• Statistical inference based on ranks

  1985cited by this paper
• Alveolar type II and Clara cells: isolation and xenobiotic metabolism.

  1984cited by this paper
• Positive correlation between high aryl hydrocarbon hydroxylase activity and primary lung cancer as analyzed in cryopreserved lymphocytes.

  1982cited by this paper
• 2,3,7,8-tetrachlorodibenzo-p-dioxin and related halogenated aromatic hydrocarbons: examination of the mechanism of toxicity.

  1982cited by this paper
• Aryl hydrocarbon hydroxylase and its components in human lung microsomes.

  1981cited by this paper
• Practical Nonparametric Statistics (2nd ed).

  1981cited by this paper
• Xenobiotic metabolism by alveolar type II cells isolated from rabbit lung.

  1981cited by this paper
• Xenobiotic metabolism in the human lung.

  1980cited by this paper
• Benzo[alpha]pyrene metabolism, activation and carcinogenesis: role and regulation of mixed-function oxidases and related enzymes.

  1980cited by this paper
• Variation of microsomal mixed function oxidase(s) and human lung cancer

  1980cited by this paper
• Oxidative biotransformation of benzo(a)pyrene by human lung microsomal fractions prepared from surgical specimens.

  1979cited by this paper
• Activities of polycyclic hydrocarbon activating and inactivating enzymes in human lungs of smokers, non-smokers, lung-cancer and non-cancer patients.

  1979cited by this paper
• Characteristics of benzo(a)pyrene metabolism by kidney, liver and lung microsomal fractions from rodents and humans.

  1979cited by this paper
• Strain-related variation in the interaction of ferritin-conjugated plant lectins with mouse mammary tumor viruses.

  1979cited by this paper
• Explant culture of human peripheral lung. I. Metabolism of benzo[alpha]pyrene.

  1978cited by this paper
• Metabolism of benzo(a)pyrene by human lung microsomal fractions.

  1977cited by this paper
• Pathologic changes in the peripheral airways of young cigarette smokers.

  1974cited by this paper
• Genetic variation of aryl hydrocarbon hydroxylase in human lymphocytes.

  1973cited by this paper
• Aryl hydrocarbon hydroxylase inducibility and bronchogenic carcinoma.

  1973cited by this paper
• Practical Nonparametric Statistics

  1972cited by this paper
• Substrate-inducible microsomal aryl hydroxylase in mammalian cell culture. I. Assay and properties of induced enzyme.

  1968cited by this paper

• Epigenetic predictor of smoking status in buccal cells.

  2025cites this paper
• Prodrugs in Oncology: Bioactivation and Impact on Therapeutic Efficacy and Toxicity

  2025cites this paper
• Toxicity, Half-Life and Antitumor Activity of Phenyl 4-(2-Oxo-3-alkylimidazolidin-1-yl)benzenesulfonates as Novel Antimitotic CYP1A1-Targeted Prodrugs in Female Mouse Models

  2025cites this paper
• Expression profiles of CYP1A1 and CYP1B1 enzymes in Non-small Cell Lung Cancer of Turkish Patients

  2025cites this paper
• Cytochrome P450 1A1 influences obesity-induced pulmonary hypertension.

  2025cites this paper
• Comparison of the behavior of human lung epithelial cell lines cultured at the air-liquid interface and assessment of their responses after benzo(a)pyrene exposure.

  2025cites this paper
• CYP1B1 Mediates Cigarette Smoke–Induced Lipid Accumulation in Alveolar Type 2 Cells

  2025cites this paper
• CYP1B1 knockout enhanced IFN-γ production is required but not sufficient for protection of cigarette smoke-exposed mice against lethal influenza virus infection

  2025cites this paper
• Identification of UDP-Glucuronosyltransferase mRNA in human platelets: differential levels in smokers and non-smokers

  2025cites this paper
• Oxidative stress promotes lipid-laden macrophage formation via CYP1B1

  2024cites this paper
• Targeting aryl hydrocarbon receptor to prevent cancer in barrier organs

  2024cites this paper
• Mapping the influence of hydrocarbons mixture on molecular mechanisms, involved in breast and lung neoplasms: in silico toxicogenomic data-mining

  2024cites this paper
• Achieving a Deeper Understanding of Drug Metabolism and Responses Using Single-Cell Technologies

  2023cites this paper
• Associations of breast cancer related exposures and gene expression profiles in normal breast tissue—The Norwegian Women and Cancer normal breast tissue study

  2023cites this paper
• Implications of xenobiotic-response element(s) and aryl hydrocarbon receptor in health and diseases

  2023cites this paper
• Effect of allyl isothiocyanate on oxidative stress in COPD via the AhR / CYP1A1 and Nrf2 / NQO1 pathways and the underlying mechanism.

  2023cites this paper
• Early-life exposure to cigarette smoke primes lung function and DNA methylation changes at Cyp1a1 upon exposure later in life

  2023cites this paper
• Early-life exposure to tobacco smoke alters airway signaling pathways and later mortality in D. melanogaster.

  2022cites this paper
• Graphical Data Representation and Analytics to Link the Potential Interaction for Lung Cancer Genes

  2022cites this paper
• Diesel exhaust particles distort lung epithelial progenitors and their fibroblast niche

  2022cites this paper
• Factors Affecting Drug Exposure after Inhalation.

  2022cites this paper
• Cytochromes P450: Role in Carcinogenesis and Relevance to Cancers.

  2022cites this paper
• The Mechanism-Based Inactivation of CYP3A4 by Ritonavir: What Mechanism?

  2022cites this paper
• Advances in the Discovery of Novel Inhaled PI3Kδ Inhibitors for the Treatment of Asthma.

  2022cites this paper
• In vitro airway models from mice, rhesus macaques, and humans maintain species differences in xenobiotic metabolism and cellular responses to naphthalene.

  2022cites this paper
• Direct transcriptomic comparison of xenobiotic metabolism and toxicity pathway induction of airway epithelium models at an air–liquid interface generated from induced pluripotent stem cells and primary bronchial epithelial cells

  2021cites this paper
• Drug Metabolism: Cytochrome P450

  2021cites this paper
• DEC1 negatively regulates CYP2B6 expression by binding to the CYP2B6 promoter region ascribed to IL-6-induced downregulation of CYP2B6 expression in HeLa cells

  2021cites this paper
• Impact of aerosols on liver xenobiotic metabolism: A comparison of two methods of exposure.

  2021cites this paper
• Potential chemopreventive, anticancer and anti-inflammatory properties of a refined artocarpin-rich wood extract of Artocarpus heterophyllus Lam.

  2021cites this paper
• Recent advances in computational metabolite structure predictions and altered metabolic pathways assessment to inform drug development processes

  2021cites this paper
• Expression profile of cytochrome P450s and effects of polycyclic aromatic hydrocarbons and antiepileptic drugs on CYP1 expression in MOG-G-CCM cells.

  2020cites this paper
• Sensing cytochrome P450 1A1 activity by a resorufin-based isoform-specific fluorescent probe

  2020cites this paper
• Comparison of the chemical composition of aerosols from heated tobacco products, electronic cigarettes and tobacco cigarettes and their toxic impacts on the human bronchial epithelial BEAS-2B cells.

  2020cites this paper
• Elevated exposure to polycyclic aromatic hydrocarbons (PAHs) may trigger cancers in Pakistan: an environmental, occupational, and genetic perspective

  2020cites this paper
• The aryl hydrocarbon receptor as a target of environmental stressors – Implications for pollution mediated stress and inflammatory responses

  2020cites this paper
• Highly Variable Expression of CYP1A1 in Human Liver and Impact on Pharmacokinetics of Riociguat and Granisetron in Humans.

  2019cites this paper
• gene promoter methylation and CYP1A1 Study of the correlation between in gastric cancer patients smoking

  2019cites this paper
• Siponimod pharmacokinetics, safety, and tolerability in combination with the potent CYP3A4 inhibitor itraconazole in healthy subjects with different CYP2C9 genotypes

  2019cites this paper
• Xenobiotica-metabolizing enzymes in the lung of experimental animals, man and in human lung models

  2019cites this paper
• Profiling of Drug-Metabolizing Enzymes and Transporters in Human Tissue Biopsy Samples: A Review of the Literature

  2019cites this paper
• Study of the correlation between CYP1A1 gene promoter methylation and smoking in gastric cancer patients

  2019cites this paper
• Specialized Proresolving Mediators in Innate and Adaptive Immune Responses in Airway Diseases.

  2018cites this paper
• Expression of cytochrome P450 mRNAs in Type II alveolar cells from subjects with chronic obstructive pulmonary disease

  2018cites this paper
• Benzo[a]pyrene activates an AhR/Src/ERK axis that contributes to CYP1A1 induction and stable DNA adducts formation in lung cells.

  2018cites this paper
• Structures of human cytochrome P450 1A1 with bergamottin and erlotinib reveal active-site modifications for binding of diverse ligands

  2018cites this paper
• CYP1A1 and 1B1‐mediated metabolic pathways of dolutegravir, an HIV integrase inhibitor

  2018cites this paper
• “The difficulty lies, not in the new ideas, but in escaping from the old ones.”

  2018cites this paper
• Assessment of the pulmonary CYP1A1 metabolism of mavoglurant (AFQ056) in rat

  2018cites this paper
• Tandem mass tags labeled quantitative proteomics to study the effect of tobacco smoke exposure on the rat lung.

  2018cites this paper
• Metabolite profiling and enzyme reaction phenotyping of luseogliflozin, a sodium–glucose cotransporter 2 inhibitor, in humans

  2017cites this paper
• Respiratory sensitization: toxicological point of view on the available assays

  2017cites this paper
• Differential Regulation of CYP3A4 and CYP3A5 and its Implication in Drug Discovery.

  2017cites this paper
• Développement de méthodes analytiques par LC-MS/MS pour la caractérisation de l’activité et de l’expression des CYP450s chez l’humain

  2017cites this paper
• Effets du diabète de type 2 sur l’expression et l’activité des cytochromes P450 hépatiques et extra-hépatiques chez la souris C57BL/6 sous une diète riche en gras

  2017cites this paper
• AHR2 morpholino knockdown reduces the toxicity of total particulate matter to zebrafish embryos.

  2016cites this paper
• CYP1A1 and CYP1B1 in human lung. PAH-bioactivation capacity, sex differences and steroid receptor mediated regulation

  2016cites this paper
• Assessment of the Effects of Renal Impairment and Smoking on the Pharmacokinetics of a Single Oral Dose of the Soluble Guanylate Cyclase Stimulator Riociguat (BAY 63-2521)

  2016cites this paper
• Assessment of the Effects of Hepatic Impairment and Smoking on the Pharmacokinetics of a Single Oral Dose of the Soluble Guanylate Cyclase Stimulator Riociguat (BAY 63-2521)

  2016cites this paper
• Impaired dacarbazine activation and 7-ethoxyresorufin deethylation in vitro by polymorphic variants of CYP1A1 and CYP1A2: implications for cancer therapy

  2016cites this paper
• Oxygen Metabolism in the Lung

  2015cites this paper
• Gene–environment interactions in esophageal cancer

  2015cites this paper
• Polycyclic aromatic hydrocarbons and cytochrome P450 in HIV pathogenesis

  2015cites this paper
• Aspirin-triggered resolvin D1 is produced during self-resolving gram-negative bacterial pneumonia and regulates host immune responses for the resolution of lung inflammation

  2015cites this paper
• Characterization of the structural determinants required for potent mechanism-based inhibition of human cytochrome P450 1A1 by cannabidiol.

  2014cites this paper
• Induction of CYP1A1, CYP1A2, CYP1B1, increased oxidative stress and inflammation in the lung and liver tissues of rats exposed to incense smoke

  2014cites this paper
• Metabolic detoxification pathways for 5-methoxy-sterigmatocystin in primary tracheal epithelial cells

  2014cites this paper
• Cytochrome P450 Polymorphisms of Clinical Importance

  2014cites this paper
• Gene expression analysis of membrane transporters and drug-metabolizing enzymes in the lung of healthy and COPD subjects

  2014cites this paper
• Ocular cytochrome P450s and transporters: roles in disease and endobiotic and xenobiotic disposition

  2014cites this paper
• Curcumin and Vitamin E Protect against Adverse Effects of Benzo[a]pyrene in Lung Epithelial Cells

  2014cites this paper
• Human Cytochrome P450 1A1 Structure and Utility in Understanding Drug and Xenobiotic Metabolism*

  2013cites this paper
• Human CYP 1 A 1 Structure and Use in Understanding Metabolism 1 Human Cytochrome P 450 1 A 1 Structure and Utility In Understanding Drug and Xenobiotic Metabolism *

  2013cites this paper
• and Xenobiotic Metabolism and Utility in Understanding Drug and Human Cytochrome P 450 1 A 1 Structure Protein Structure and Folding

  2013cites this paper
• Risk of cancer after coal tar treatment

  2013cites this paper
• The development of models for the evaluation of pulmonary drug disposition

  2013cites this paper
• Extra-hepatic isozymes from the CYP1 and CYP2 families as potential chemotherapeutic targets.

  2013cites this paper
• In vitro effects of aldehydes present in tobacco smoke on gene expression in human lung alveolar epithelial cells.

  2013cites this paper
• The GSTM1null (deletion) and MGMT84 rs12917 (Phe/Phe) haplotype are associated with bulky DNA adduct levels in human leukocytes.

  2013cites this paper
• Genotoxic bioactivation of constituents of a diesel exhaust particle extract by the human lung

  2013cites this paper
• The and are associated with bulky DNA adduct levels in human leukocytes

  2013cites this paper
• CYP1B1 L432V Polymorphism and Lung Cancer Risk in the Iranian Population

  2013cites this paper
• Structural requirements for potent direct inhibition of human cytochrome P450 1A1 by cannabidiol: role of pentylresorcinol moiety.

  2013cites this paper
• CYP 1 B 1 L 432 V Polymorphism and Lung Cancer Risk in the Iranian Population

  2013cites this paper
• Aryl hydrocarbon receptor and lung cancer.

  2013cites this paper
• Quantitation of the metabolic activation of phenanthrene in smokers:potential use in the assessment of lung cancer susceptibility

  2012cites this paper
• Optimisation of DMPK by the inhaled route: challenges and approaches.

  2012cites this paper
• Extrahepatic Drug-Metabolizing Enzymes and Their Significance

  2012cites this paper
• Effects of flavonoids on CYP1 expression in RL95-2 endometrial carcinoma cells

  2012cites this paper
• An ex vivo approach to the differential parenchymal responses induced by cigarette whole smoke and its vapor phase.

  2012cites this paper
• Rapid identification of CYP2C8 polymorphisms by high resolution melting analysis.

  2012cites this paper
• DNA adducts in skin biopsies and 1-hydroxypyrene in urine of psoriasis patients and healthy volunteers following treatment with coal tar.

  2012cites this paper
• CTCAGAAA GGAGGGAGCTTCCTTCTCCT GCTGTCTT CCTTTGCAATTGGCTGGAG AGCGACTTA CCTCACCCCAGTTACCAAAG CTCCCAGT TGAAGACAGGTAACTGTTAAGGTCA AACAAATGCAAA AACGGAGCAGATCACATTGC TGATCCCA ATCCTGAAGTTTTCATTGAATC GAAACGAT CAAGTCTTCCCTACAACCTTGA CTTGGTGT TCACAAAATGGACAAGAAATCAA TATACTGGCA TCAGCATTGTTCTGAAATTCACT ATCTTCGTT

  2011cites this paper
• Metabolism of [D10]Phenanthrene to Tetraols in Smokers for Potential Lung Cancer Susceptibility Assessment: Comparison of Oral and Inhalation Routes of Administration

  2011cites this paper
• Metabolism and biomarkers of heterocyclic aromatic amines in molecular epidemiology studies: lessons learned from aromatic amines.

  2011cites this paper
• Corneal damage and lacrimal gland dysfunction in a smoking rat model.

  2011cites this paper
• Cytochrome P450-mediated pulmonary metabolism of carcinogens: regulation and cross-talk in lung carcinogenesis.

  2011cites this paper
• Urinary levels of cigarette smoke constituent metabolites are prospectively associated with lung cancer development in smokers.

  2011cites this paper
• Comparative gene responses to collected ambient particles in vitro: endothelial responses.

  2011cites this paper
• Cyp1B1 mRNA expression in correlation to cotinine levels with respect to the Cyp1B1 L432V gene polymorphism

  2010cites this paper