An abnormal plasma distribution of protein S occurs in functional protein S deficiency.

No abstract is available for this paper.

• Publication year

  1986

• Venue

  Blood

• Publication date

  1986-02-01

• Fields of study

  Biology, Medicine

• Identifiers
  DOI 10.1182/BLOOD.V67.2.504.504PMID 2935211
• External record

  Open on Semantic Scholar

• Source metadata

  Semantic Scholar, PubMed

• No claims are published for this paper.

• No concepts are published for this paper.

• Determination of functional levels of protein C, an antithrombotic protein, using thrombin-thrombomodulin complex.

  1984cited by this paper
• Plasma protein S deficiency in familial thrombotic disease.

  1984cited by this paper
• Detection of protein C activation in humans.

  1984cited by this paper
• Familial protein S deficiency is associated with recurrent thrombosis.

  1984cited by this paper
• Recurrent venous thromboembolism in patients with a partial deficiency of protein S.

  1984cited by this paper
• Purification of human vitamin K-dependent protein S and its limited proteolysis by thrombin.

  1983cited by this paper
• Quantitative Crossed Immunoelectrophoresis—A Convenient Procedure for the Simultaneous Quantitation of Various Molecular Forms of an Antigen

  1983cited by this paper
• High molecular weight complex in human plasma between vitamin K-dependent protein S and complement component C4b-binding protein.

  1981cited by this paper
• Deficiency of protein C in congenital thrombotic disease.

  1981cited by this paper
• Regulation of activated protein C by a new protein. A possible function for bovine protein S.

  1980cited by this paper
• Crossed immunoelectrophoresis.

  1972cited by this paper

• Activated protein C and free protein S in patients with mild to moderate bleeding disorders.

  2024cites this paper
• The impact of PROS1 mutation position on thrombotic risk in protein S–deficient patients

  2023cites this paper
• Haemostasis and Inflammatory Parameters as Potential Diagnostic Biomarkers for VTE in Trauma-Immobilized Patients

  2023cites this paper
• A Case of Type 2 Protein S Deficiency Presenting as Cerebral Venous Thrombosis (CVT) in an 18-Year-Old Female

  2022cites this paper
• [Thromboembolic complications in nephrotic syndrome].

  2020cites this paper
• Thrombophilia: Hereditary and Acquired

  2019cites this paper
• stondordisolion of Prolein S in Plosmo : coribrqlion of the lsl lnternolionol

  2018cites this paper
• SepticShock,MultipleOrganFailure,and Disseminated Intravascular Coagulation* ComparedPatternsof Antithrombin III, ProteinC, andProteinS Deficiencies

  2017cites this paper
• 19 – Investigation of a Thrombotic Tendency

  2017cites this paper
• Thrombose veineuse cérébrale en tout début de grossesse avec déficit en protéine S: une association assez rarement diagnostiquée en zone tropicale: à propos d’un cas

  2016cites this paper
• 42 – Hematologic Disorders and Stroke

  2016cites this paper
• Primary Nephrotic Syndrome in Adults as a Risk Factor for Pulmonary Embolism: An Up-to-Date Review of the Literature

  2014cites this paper
• Multiple presence of prothrombotic risk factors in Croatian children with arterial ischemic stroke and transient ischemic attack

  2013cites this paper
• Polyphosphate as a modulator of the complement system

  2013cites this paper
• Endogenous anticoagulants.

  2012cites this paper
• Recombinant Technology in Hemostasis and Thrombosis

  2012cites this paper
• A Female with Recurrent Venous Thrombosis

  2012cites this paper
• coagulant response to Escherichia coli Role of free protein S and C4b binding protein in regulating the

  2011cites this paper
• healthy human fetus Evolution of blood coagulation activators and inhibitors in the

  2011cites this paper
• Decreased free protein S levels and venous thrombosis in the acute setting, a case-control study.

  2011cites this paper
• Contraception-Related Deep Venous Thrombosis and Pulmonary Embolism in a 17-Year-Old Girl Heterozygous for Factor V Leiden, Prothrombin G20210A Mutation, MTHFR C677T and Homozygous for PAI-1 Mutation: Report of a Family with Multiple Genetic Risk Factors and Review of the Literature

  2010cites this paper
• Assessment of Plasma Protein S FunctioRal Activity and Patients with Liver Cirrhosis Antigen in

  2010cites this paper
• Systemic inflammatory response following acute traumatic brain injury.

  2009cites this paper
• Gross deletions/duplications in PROS1 are relatively common in point mutation-negative hereditary protein S deficiency

  2009cites this paper
• NODULAR REGENERATIVE HYPERPLASIA IN HIV INFECTION: A PUZZLING CASE OF PORTAL HYPERTENSION IN A PATIENT COINFECTED WITH HUMAN IMMUNODEFICIENCY AND HEPATITIS C VIRUSES

  2009cites this paper
• 17 – Investigación de la tendencia trombótica

  2008cites this paper
• Peculiar rocket profile in the electroimmunoassay of protein-S-deficient plasma: a clue to diagnosis?

  2008cites this paper
• [A puzzling case of portal hypertension in a patient with human immunodeficiency and hepatitis C virus co-infection].

  2007cites this paper
• Hypertension portale chez un malade coinfecté par le virus de l’immunodéficience humaine et le virus de l’hépatite C

  2007cites this paper
• Meningococcemia and purpura fulminans in adults: acute deficiencies of proteins C and S and early treatment with antithrombin III concentrates

  2007cites this paper
• Protein S deficiency and lower-extremity arterial thrombosis: complicating a common presentation.

  2007cites this paper
• Influence of PROS1 gene mutations affecting protein S amino-acid 275 on plasma free protein S measurement

  2007cites this paper
• Pulmonary and Deep Vein Thrombosis in a Young Patient with Protein S Deficiency: Report of a Case

  2007cites this paper
• Thrombophilia: Clinical and Laboratory Assessment and Management

  2007cites this paper
• Laboratory Tests for the Diagnosis of Thrombotic Disorders

  2006cites this paper
• A Case-Control Study

  2005cites this paper
• Meningococcemia and purpura fulminans in adults: Acute deficiencies of proteins C and S and early treatment with antithrombin III concentrates

  2005cites this paper
• Free Protein S Deficiency in Acute Ischemic Stroke A Case-Control Study

  2005cites this paper
• Thrombophilia in children with cystic fibrosis

  2005cites this paper
• Protein S and congenital protein S deficiency: the most frequent congenital thrombophilia in Japanese.

  2005cites this paper
• Hereditary Protein S Deficiency and Recurrent Venous Thrombosis: A Case Report

  2004cites this paper
• A Monoclonal Antibody to Human Protein S Used as the Capture Antibody for Measuring Total Protein S by Enzyme Immunoassay

  2004influential citation
• Evaluation of Hypercoagulable States

  2004cites this paper
• Direct anticoagulant activity of protein S‐C4b binding protein complex in Heerlen heterozygotes and normals *

  2004cites this paper
• Coagulation Abnormalities in Stroke

  2004cites this paper
• Studieson the Measurementof ProteinS in Plasma

  2004influential citation
• Die klinische bedeutung von protein-C- und -S-Mangelzuständen für das chirurgische patientenkollektiv

  2004cites this paper
• Changes in the fibrinolytic system associated with physical conditioning

  2004cites this paper
• Screening for thrombophilia: a laboratory perspective

  2003cites this paper
• Combined antithrombin and protein C supplementation in meningococcal purpura fulminans: a pharmacokinetic study

  2003cites this paper
• Deficiency of Protein S-Mediated Familial Venous Thrombophilia

  2003cites this paper
• Effect of a common reference plasma on the inter-laboratory variation of the measurement of total and free protein S: a collaborative study of the Dutch Working Group on Haemostasis Laboratory Diagnosis

  2002cites this paper
• A review of the technical, diagnostic, and epidemiologic considerations for protein S assays.

  2002cites this paper
• Trombosis venosa cerebral del posparto

  2002cites this paper
• Protein S deficiency manifesting as spontaneous aortic thrombosis in a neonate

  2002cites this paper
• PSCysS PSCysA PSAlaS PSAlaA PSGluS PSGluA PSLysS PSLvsA CCCTCGTCTAGATGGATGTA AGTGGTGTCGACAACTCCAG CTTGAATAT ETCCATCCAC GTGGATGGACAAATATTCAAG CCTGAATATGCTCCATCCACGG CCGTGGATGGAGCAATATCAAGG ACCTGAATATGAACCATCCACGGGC GCCCGTGGATGG ‘ TTCAATATTCAAGGT ACCTTGAATATTAAACCATCCACGGGC GCCCGTGGATGG

  2002cites this paper
• Reduced Free Protein S Levels in Patients with Inflammatory Bowel Disease

  2001cites this paper
• A direct, automated, immuno-turbidimetric assay of free protein S antigen in plasma

  2001cites this paper
• Upper Extremity Deep Venous Thrombosis: An Underrecognized Manifestation of a Hypercoagulable State

  2000cites this paper
• Scientific and Standardization Committee Communication Protein S Deficiency: A Database of Mutations - FIRST UPDATE For the Plasma Coagulation Inhibitors Subcommittee of the Scientific and Standardization Committee of the International Society on Thrombosis and Haemostasis

  2000cites this paper
• HIGH RISK OF CEREBRAL-VEIN THROMBOSIS IN CARRIERS OF A PROTHROMBIN-GENE MUTATION AND IN USERS OF ORAL CONTRACEPTIVES

  2000cites this paper
• Sagittal sinus thrombosis associated with transient free protein S deficiency after L-asparaginase treatment: case report and review of the literature.

  2000cites this paper
• Hemostatic Changes following the Modified Fontan Operation (Total Cavopulmonary Connection)

  2000cites this paper
• Expression of the beta-chain of the complement regulator C4b-binding protein in human ovary.

  1999cites this paper
• Dural sinus thrombosis in a patient with protein S deficiency--case report.

  1999cites this paper
• Genetic Risk Factors for Superficial Vein Thrombosis

  1999cites this paper
• Protein S activity

  1999cites this paper
• Genetic Modulation of Plasma Protein S Levels by Two Frequent Dimorphisms in the PROS1 Gene

  1999cites this paper
• Primary thrombophilia in Mexico: A prospective study

  1999cites this paper
• Compound Heterozygosity for One Novel and One Recurrent Mutation in a Thai Patient with Severe Protein S Deficiency

  1999cites this paper
• Screening for Aetiology of Thrombophilia: A High Prevalence of Protein S Abnormality

  1999cites this paper
• Laboratory Techniques in Thrombosis — a Manual

  1999cites this paper
• Interaction between the G20210A mutation of the prothrombin gene and oral contraceptive use in deep vein thrombosis.

  1999cites this paper
• Protein S antigen

  1999cites this paper
• Anticardiolipin antibodies, free protein S levels and thrombosis: a survey in a selected population of rheumatoid arthritis patients.

  1999cites this paper
• Enhancement of protein S anticoagulant function by beta2-glycoprotein I, a major target antigen of antiphospholipid antibodies: beta2-glycoprotein I interferes with binding of protein S to its plasma inhibitor, C4b-binding protein.

  1999cites this paper
• Interaction Between the G 20210 A Mutation of the Prothrombin Gene and Oral Contraceptive Use in Deep Vein Thrombosis

  1999cites this paper
• Laboratory Investigation of Hypercoagulability

  1998cites this paper
• One-step assay for the determination of free protein S antigen in plasma using real-time biospecific interaction analysis.

  1998cites this paper
• A New Direct, Fast and Quantitative Enzyme-linked Ligandsorbent Assay for Measurement of Free Protein S Antigen

  1998influential citation
• Thrombin generation and activation of the thrombomodulin protein C system in open heart surgery depend on the underlying cardiac disease.

  1998cites this paper
• Different risks of thrombosis in four coagulation defects associated with inherited thrombophilia: a study of 150 families.

  1998cites this paper
• Increased risk of venous thrombosis in carriers of natural anticoagulant deficiencies. Results of the family studies of the Spanish Multicenter Study on Thrombophilia (EMET study).

  1998cites this paper
• Lack of sequence variations in the C4b‐BP β‐chain in patients with type III protein S deficiency bearing the Ser 460 to Pro mutation: description of two new intragenic isomorphisms in the C4b‐BP β‐chain gene (C4BPB)

  1998cites this paper
• Syndromes of Thrombosis and Hypercoagulability: Congenital and Acquired Thrombophilias

  1998cites this paper
• Simultaneous assay of free and total protein S by ELISA using monoclonal and polyclonal antibodies.

  1998cites this paper
• [Mesenteric arterial thrombosis in protein S deficiency].

  1998cites this paper
• High risk of cerebral-vein thrombosis in carriers of a prothrombin-gene mutation and in users of oral contraceptives.

  1998cites this paper
• Syndromes of thrombosis and hypercoagulability. Congenital and acquired causes of thrombosis.

  1998cites this paper
• Spontaneous tibial artery thrombosis associated with varicella pneumonia and free protein S deficiency.

  1998cites this paper
• Protein C, protein S and antithrombin III in children with portal vein obstruction.

  1997cites this paper
• A simple monoclonal antibody based ELISA for free protein S. Comparison with PEG precipitation.

  1997cites this paper
• A 41-year-old woman with protein S deficiency and diffuse proliferative lupus nephritis: is protein S deficiency associated with a hyperinflammatory response?

  1997cites this paper
• Free Protein S Deficiency Is a Risk Factor for Venous Thrombosis

  1997cites this paper
• Prevalence of the Prothrombin Gene Variant (nt20210A) in Venous Thrombosis and Arterial Disease

  1997cites this paper
• Protein C and S deficiency in children with ischemic cerebrovascular accident.

  1997cites this paper
• Causes and outcome of deep-vein thrombosis in otherwise-healthy patients under 50 years.

  1997cites this paper
• Thrombosis in congenital deficiencies of AT III, protein C or protein S: a study of 44 children.

  1997cites this paper
• Laboratory Evaluation and Clinical Characteristics of 2,132 Consecutive Unselected Patients with Venous Thromboembolism – Results of the Spanish Multicentric Study on Thrombophilia (EMET*-Study)

  1997cites this paper
• Resistance to activated protein C and low levels of protein S activity in nine thrombophilic families: a correct diagnosis.

  1997cites this paper