Correlation between increased ND2 expression and demethylated displacement loop of mtDNA in colorectal cancer.

No abstract is available for this paper.

• Publication year

  2012

• Venue

  Molecular Medicine Reports

• Publication date

  2012-07-01

• Fields of study

  Biology, Medicine

• Identifiers
  DOI 10.3892/mmr.2012.870PMID 22505229
• External record

  Open on Semantic Scholar

• Source metadata

  Semantic Scholar, PubMed

• No claims are published for this paper.

• No concepts are published for this paper.

• Replication timing-related and gene body-specific methylation of active human genes.

  2011cited by this paper
• Down-regulation of VEZT gene expression in human gastric cancer involves promoter methylation and miR-43c.

  2011cited by this paper
• Correlation between increased copy number of mitochondrial DNA and clinicopathological stage in colorectal cancer.

  2011cited by this paper
• Global DNA methylation, DNMT1, and MBD2 in patients with rheumatoid arthritis.

  2011cited by this paper
• Global cancer statistics

  2011cited by this paper
• The role of the DNA hypermethylating agent Budesonide in the decatenating activity of DNA topoisomerase II.

  2010cited by this paper
• Chk2 down-regulation by promoter hypermethylation in human bulk gliomas.

  2010cited by this paper
• Methylation of DNA in cancer.

  2010cited by this paper
• In vivo methylation of mtDNA reveals the dynamics of protein–mtDNA interactions

  2009cited by this paper
• Region-specific changes in mitochondrial D-loop in aged rat CNS.

  2009cited by this paper
• Multiparameter metabolic analysis reveals a close link between attenuated mitochondrial bioenergetic function and enhanced glycolysis dependency in human tumor cells.

  2007cited by this paper
• Metabolic changes during carcinogenesis: potential impact on invasiveness.

  2007cited by this paper
• The epigenetic progenitor origin of human cancer

  2006cited by this paper
• Mitochondria and cancer: is there a morphological connection?

  2006cited by this paper
• Glucose metabolism and cancer.

  2006cited by this paper
• Epigenetic gene silencing in cancer – a mechanism for early oncogenic pathway addiction?

  2006cited by this paper
• Lack of age-related increase of mitochondrial DNA amount in brain, skeletal muscle and human heart.

  2005cited by this paper
• Cancer metabolism: facts, fantasy, and fiction.

  2004cited by this paper
• The bioenergetic signature of cancer: a marker of tumor progression.

  2002cited by this paper
• CpG island hypermethylation and tumor suppressor genes: a booming present, a brighter future

  2002cited by this paper
• Primary cell cultures of bovine colon epithelium: isolation and cell culture of colonocytes.

  2000cited by this paper
• The mitochondrial genome: structure, transcription, translation and replication.

  1999cited by this paper
• Increased steady-state levels of several mitochondrial and nuclear gene transcripts in rat hepatoma with a low content of mitochondria.

  1992cited by this paper
• Mitochondrial DNA. Small, beautiful and essential.

  1989cited by this paper
• Sequence and organization of the human mitochondrial genome

  1981cited by this paper
• “Field cancerization” in oral stratified squamous epithelium. Clinical implications of multicentric origin

  1953cited by this paper

• Mitochondrial epigenetic mechanisms in cancer: an updated overview

  2026cites this paper
• Mitochondrial DNA methylation is involved in contrast-induced renal tubular epithelial cell injury

  2025cites this paper
• Mitochondrial DNA Methylation: Existence, Localization, and Function

  2025influential citation
• Targeting the epigenome and tumor heterogeneity: advances in immunotherapy for chemoresistant metastatic colorectal cancer

  2025cites this paper
• Multi-omics revealed GOT1/ALDH3A1 pathway attenuated head and neck squamous cell carcinoma and increased cisplatin sensitivity through ROS induced by mitochondrial dysfunction

  2025cites this paper
• Epigenetic mechanisms linking environmental exposure to Parkinson's disease: A comprehensive review.

  2025cites this paper
• G-quadruplex propensity in H. neanderthalensis, H. sapiens and Denisovans mitochondrial genomes

  2024cites this paper
• Associations between Circulating Biomarkers of One-Carbon Metabolism and Mitochondrial D-Loop Region Methylation Levels

  2024cites this paper
• Deregulation of mitochondrial gene expression in cancer: mechanisms and therapeutic opportunities

  2024cites this paper
• Epigenetic signatures of social status in wild female spotted hyenas (Crocuta crocuta)

  2024cites this paper
• Comparison between D-loop methylation and mtDNA copy number in patients with Aicardi-Goutières Syndrome

  2023cites this paper
• Mitochondrial DNA-targeted therapy: A novel approach to combat cancer

  2023cites this paper
• Characterization of Mitochondrial DNA Methylation of Alzheimer’s Disease in Plasma Cell-Free DNA

  2023cites this paper
• Mitochondrial remodeling in colorectal cancer initiation, progression, metastasis, and therapy: A review.

  2023cites this paper
• Mitochondrial Inheritance Following Nuclear Transfer: From Cloned Animals to Patients with Mitochondrial Disease.

  2023cites this paper
• The prenatal environment and its influence on maternal and child mitochondrial DNA copy number and methylation: A review of the literature.

  2023cites this paper
• Genome-wide characterization of mitochondrial DNA methylation in human brain

  2023cites this paper
• Interplay between environmental exposure and mitochondrial DNA methylation in disease susceptibility and cancer: a comprehensive review

  2022cites this paper
• The nanopore sequencing of a Chinese rhesus macaque revealed patterns of methylation, recombination, and selection for structural variations

  2022cites this paper
• Association between diesel exhaust exposure and mitochondrial DNA methylation.

  2022cites this paper
• Targeted Mitochondrial Epigenetics: A New Direction in Alzheimer’s Disease Treatment

  2022cites this paper
• No evidence of extensive non-CpG methylation in mtDNA

  2022cites this paper
• The Mitochondrial Epigenome: An Unexplored Avenue to Explain Unexplained Myopathies?

  2022cites this paper
• Mitochondrial and metabolic dysfunction in ageing and age-related diseases

  2022cites this paper
• Mutation Profile of Neurodegenerative Mitochondriopathy - LHON in Southern India.

  2022cites this paper
• Mitochondrial DNA Methylation Is Higher in Acute Coronary Syndrome Than in Stable Coronary Artery Disease

  2021cites this paper
• Placental mtDNA copy number and methylation in association with macrosomia in healthy pregnancy.

  2021cites this paper
• Mitochondrial Heteroplasmy Shifting as a Potential Biomarker of Cancer Progression

  2021cites this paper
• The first mitochondrial 5-methylcytosine map in a non-model teleost (Oreochromis niloticus) reveals extensive strand-specific and non-CpG methylation.

  2021cites this paper
• Mutual Correlation between Non-Coding RNA and S-Adenosylmethionine in Human Cancer: Roles and Therapeutic Opportunities

  2021cites this paper
• Peripheral blood DNA and RNA biomarkers of cardiovascular disease in clinical practice

  2021cites this paper
• Mitochondrial DNA Methylation and Human Diseases

  2021cites this paper
• Low biological fluctuation of mitochondrial CpG and non-CpG methylation at the single-molecule level

  2021cites this paper
• Hypermethylation of Mitochondrial Cytochrome b and Cytochrome c Oxidase II Genes with Decreased Mitochondrial DNA Copy Numbers in the APP/PS1 Transgenic Mouse Model of Alzheimer’s Disease

  2021cites this paper
• Mitochondrial DNA methylation in placental tissue: a proof of concept study by means of prenatal environmental stressors

  2020cites this paper
• Mitochondrial epigenetics: an unnoticed phenomenon in mitochondrial gene expression

  2020cites this paper
• Complexities and pitfalls in analyzing and interpreting mitochondrial DNA content in human cancer.

  2020cites this paper
• Minimal detection and low biological fluctuation of mitochondrial CpG methylation at the single-molecule level

  2020cites this paper
• Reduced mitochondrial D-loop methylation levels in sporadic amyotrophic lateral sclerosis

  2020cites this paper
• A Pilot Study on the Effects of l-Carnitine and Trimethylamine-N-Oxide on Platelet Mitochondrial DNA Methylation and CVD Biomarkers in Aged Women

  2020cites this paper
• Hypermethylation of mitochondrial DNA in vascular smooth muscle cells impairs cell contractility

  2020cites this paper
• The correlated expression of immune and energy metabolism related genes in the response to Salmonella enterica serovar Enteritidis inoculation in chicken

  2020cites this paper
• Platelet mitochondrial DNA methylation predicts future cardiovascular outcome in adults with overweight and obesity

  2020cites this paper
• Human mitochondrial DNA is extensively methylated in a non-CpG context

  2019cites this paper
• Mitoepigenetics and Neurodegenerative Diseases

  2019cites this paper
• Effects of air pollution on mitochondrial function, mitochondrial DNA methylation, and mitochondrial peptide expression.

  2019cites this paper
• Welding Fume Exposure and Epigenetic Alterations: A Systematic Review

  2019cites this paper
• Identifying pig mitochondrial TSS: Structure and functional features.

  2019cites this paper
• Polyurethane foam induces epigenetic modification of mitochondrial DNA during different metamorphic stages of Tenebrio molitor.

  2019cites this paper
• Profiles of mitochondrial DNA methylation in the ridgetail white prawn, Exopalaemon carinicauda (Holthuis, 1950) (Decapoda, Palaemonidae) under heavy metal stress from chromium and cadmium

  2019cites this paper
• Altered mitochondrial DNA methylation and mitochondrial DNA copy number in an APP/PS1 transgenic mouse model of Alzheimer disease.

  2019cites this paper
• Épigénétique mitochondriale chez des espèces avec DUI

  2019cites this paper
• Epigenetic Mechanisms of Traumatic Brain Injuries.

  2018cites this paper
• Epigenetic Epidemiology for Cancer Risk

  2018cites this paper
• Reduced nuclear DNA methylation and mitochondrial transcript changes in adenomas do not associate with mtDNA methylation

  2018influential citation
• Homocysteine impairs porcine oocyte quality via deregulation of one-carbon metabolism and hypermethylation of mitochondrial DNA†.

  2018cites this paper
• Principal Aspects Regarding the Maintenance of Mammalian Mitochondrial Genome Integrity

  2017cites this paper
• Current and upcoming mitochondrial targets for cancer therapy.

  2017cites this paper
• Can Mitochondria DNA Provide a Novel Biomarker for Evaluating the Risk and Prognosis of Colorectal Cancer?

  2017cites this paper
• Roles of Mitochondrial DNA Signaling in Immune Responses.

  2017cites this paper
• Occupational exposure to particles and mitochondrial DNA - relevance for blood pressure

  2017cites this paper
• Decreased Methylation of the Mitochondrial D-Loop Region in Late-Onset Alzheimer’s Disease

  2017cites this paper
• Epigenetic Modification of mitochondrial genes in Alzheimer's disease (AD)

  2017cites this paper
• Mitochondrial genome and epigenome: two sides of the same coin.

  2017cites this paper
• Regulation of mitochondrial gene expression, the epigenetic enigma.

  2017influential citation
• Diabetic retinopathy, metabolic memory and epigenetic modifications.

  2017cites this paper
• Regional differences in mitochondrial DNA methylation in human post-mortem brain tissue

  2017cites this paper
• Experimental mitochondria-targeted DNA methylation identifies GpC methylation, not CpG methylation, as potential regulator of mitochondrial gene expression

  2017cites this paper
• Evidence Suggesting Absence of Mitochondrial DNA Methylation

  2017cites this paper
• Maternal trans-general analysis of the human mitochondrial DNA pattern.

  2017cites this paper
• Epigenetics in Parkinson's Disease.

  2017cites this paper
• Mitochondrial DNA alteration and pathological progression in colorectal cancer

  2016cites this paper
• Effects of Air Pollution and Blood Mitochondrial DNA Methylation on Markers of Heart Rate Variability

  2016cites this paper
• Maternal smoking during pregnancy is associated with mitochondrial DNA methylation

  2016cites this paper
• Dietary lipid concentration affects liver mitochondrial DNA copy number, gene expression and DNA methylation in large yellow croaker (Larimichthys crocea).

  2016cites this paper
• The expression characteristics of mt-ND2 gene in chicken

  2016cites this paper
• General summary and future perspectives

  2016cites this paper
• Association of methylation marks in monocyte nuclear DNA and platelet mitochondrial DNA with the risk of myocardial infarction

  2016cites this paper
• Epigenetic regulation of mitochondrial function in neurodegenerative disease: New insights from advances in genomic technologies.

  2016cites this paper
• Quantification of global mitochondrial DNA methylation levels and inverse correlation with age at two CpG sites

  2016cites this paper
• Mitochondrial Dysfunction in Autism Spectrum Disorders.

  2016cites this paper
• Abnormally activated one-carbon metabolic pathway is associated with mtDNA hypermethylation and mitochondrial malfunction in the oocytes of polycystic gilt ovaries

  2016cites this paper
• General summary and future perspectives

  2016cites this paper
• Towards revealing the function of mitochondrial DNA methylation

  2016cites this paper
• INVESTIGATING THE PRESENCE OF MITOCHONDRIAL DNA METHYLATION, ITS ALTERATION AND ASSOCIATION WITH MITOCHONDRIAL TRANSCRIPTION AND MITOCHONDRIAL FUNCTION

  2015cites this paper
• CTCCACTGCT TATGGCGGCTGAGGAAG TCAAACTGTGG GTGCCAACCTGGATGAGC TATGGCAACGA GGTCACTGGCATTGGTCAC GATCCACGAAGCC TGGTCTTTCCAGTGAGTATGAGCC GTTATGCCCTGCC TGAAGGAGTAACCGCGCTCTGT GGACGCACACTG GCAGACGGGCATAGCACTTG AGCCTAACAT TACCTCCAGACAGCACGG CCATAGCCCACA GTGGCTGGCACGAGTTTGA AGCCTTCATT GCGATGAATAGGGAAAGCA GGTG

  2015cites this paper
• The epigenetics of aging and neurodegeneration.

  2015cites this paper
• Placental mitochondrial methylation and exposure to airborne particulate matter in the early life environment: An ENVIRONAGE birth cohort study

  2015cites this paper
• Mitochondria in health, aging and diseases: the epigenetic perspective

  2015cites this paper
• Deciphering the spectrum of somatic mutations in the entire mitochondrial DNA genome.

  2015cites this paper
• Epigenetic Modification of Mitochondrial DNA in the Development of Diabetic Retinopathy.

  2015cites this paper
• Age-and gender-related pattern of methylation in the MT-RNR1 gene.

  2015cites this paper
• Platelet mitochondrial DNA methylation: a potential new marker of cardiovascular disease

  2015cites this paper
• Dietary Olive and Perilla Oils Affect Liver Mitochondrial DNA Methylation in the Large

  2015cites this paper
• De-methylation of displacement loop of mitochondrial DNA is associated with increased mitochondrial copy number and nicotinamide adenine dinucleotide subunit 2 expression in colorectal cancer.

  2015cites this paper
• Dietary Olive and Perilla Oils Affect Liver Mitochondrial DNA Methylation in Large Yellow Croakers.

  2015cites this paper
• Can diet influence the selective advantage of mitochondrial DNA haplotypes ?

  2015cites this paper
• Epigenetic effects of low perinatal doses of flame retardant BDE-47 on mitochondrial and nuclear genes in rat offspring.

  2015cites this paper
• Review: can diet influence the selective advantage of mitochondrial DNA haplotypes?

  2015cites this paper
• Environmental exposure and mitochondrial epigenetics: study design and analytical challenges

  2014influential citation