Voltage-gated Na+ channels: multiplicity of expression, plasticity, functional implications and pathophysiological aspects

No abstract is available for this paper.

• Publication year

  2004

• Venue

  European Biophysics Journal

• Publication date

  2004-02-12

• Fields of study

  Biology, Medicine

• Identifiers
  DOI 10.1007/s00249-004-0389-0PMID 14963621
• External record

  Open on Semantic Scholar

• Source metadata

  Semantic Scholar, PubMed

• No claims are published for this paper.

• No concepts are published for this paper.

• Voltage-gated sodium channel toxins

  2007cited by this paper
• Cancer epigenetics.

  2005cited by this paper
• Modulation of Nav1.7 and Nav1.8 peripheral nerve sodium channels by protein kinase A and protein kinase C.

  2004cited by this paper
• International Union of Pharmacology: Approaches to the Nomenclature of Voltage-Gated Ion Channels

  2003cited by this paper
• Cancer epigenetics

  2003cited by this paper
• Overview of the voltage-gated sodium channel family

  2003cited by this paper
• Type B brevetoxins show tissue selectivity for voltage-gated sodium channels: comparison of brain, skeletal muscle and cardiac sodium channels.

  2003cited by this paper
• International Union of Pharmacology. XLI. Compendium of voltage-gated ion channels: potassium channels.

  2003cited by this paper
• Contribution of functional voltage‐gated Na+ channel expression to cell behaviors involved in the metastatic cascade in rat prostate cancer: II. Secretory membrane activity

  2003cited by this paper
• Sialic acid contributes to generation of ectopic spontaneous discharges in rats with neuropathic pain.

  2003cited by this paper
• Transmitter modulation of slow, activity-dependent alterations in sodium channel availability endows neurons with a novel form of cellular plasticity.

  2003cited by this paper
• A Targeting Motif Involved in Sodium Channel Clustering at the Axonal Initial Segment

  2003cited by this paper
• International Union of Pharmacology. XXXIX. Compendium of Voltage-Gated Ion Channels: Sodium Channels

  2003cited by this paper
• Sodium channel beta4, a new disulfide-linked auxiliary subunit with similarity to beta2.

  2003cited by this paper
• State‐dependent access to the batrachotoxin receptor on the sodium channel

  2003cited by this paper
• Isoform-specific effects of a novel BmK 11(2) peptide toxin on Na channels.

  2003cited by this paper
• Sodium Channel β4, a New Disulfide-Linked Auxiliary Subunit with Similarity to β2

  2003influential reference
• Identification of a Conserved Ankyrin-binding Motif in the Family of Sodium Channel α Subunits*

  2003cited by this paper
• Contribution of functional voltage‐gated Na+ channel expression to cell behaviors involved in the metastatic cascade in rat prostate cancer: I. lateral motility

  2003cited by this paper
• Modulation of the Cardiac Sodium Channel Nav1.5 by Fibroblast Growth Factor Homologous Factor 1B*

  2003cited by this paper
• Downregulation of voltage-gated sodium channels by dexamethasone in clonal rat pituitary cells.

  2003cited by this paper
• Calmodulin Binds to the C Terminus of Sodium Channels Nav1.4 and Nav1.6 and Differentially Modulates Their Functional Properties

  2003cited by this paper
• Sensory neuron proteins interact with the intracellular domains of sodium channel NaV1.8.

  2003cited by this paper
• GTP‐induced tetrodotoxin‐resistant Na+ current regulates excitability in mouse and rat small diameter sensory neurones

  2003cited by this paper
• Redistribution of NaV1.8 in Uninjured Axons Enables Neuropathic Pain

  2003cited by this paper
• Destabilization of Nav1.7 Sodium Channel α-Subunit mRNA by Constitutive Phosphorylation of Extracellular Signal-Regulated Kinase: Negative Regulation of Steady-State Level of Cell Surface Functional Sodium Channels in Adrenal Chromaffin Cells

  2003cited by this paper
• Involvement of a novel fast inward sodium current in the invasion capacity of a breast cancer cell line.

  2003cited by this paper
• Regulatory interaction of sodium channel IQ-motif with calmodulin C-terminal lobe.

  2003cited by this paper
• An unexpected requirement for brain-type sodium channels for control of heart rate in the mouse sinoatrial node

  2003cited by this paper
• Destabilization of Na(v)1.7 sodium channel alpha-subunit mRNA by constitutive phosphorylation of extracellular signal-regulated kinase: negative regulation of steady-state level of cell surface functional sodium channels in adrenal chromaffin cells.

  2003cited by this paper
• The role of voltage-gated sodium channels in neuropathic pain.

  2003cited by this paper
• The permeation and activation properties of brain sodium channels change during development.

  2003cited by this paper
• Functional Specialization of the Axon Initial Segment by Isoform-Specific Sodium Channel Targeting

  2003cited by this paper
• Functional Expression of GFP-linked Human Heart Sodium Channel (hH1) and Subcellular Localization of the a Subunit in HEK293 Cells and Dog Cardiac Myocytes

  2002influential reference
• Beta subunits: players in neuronal hyperexcitability?

  2002influential reference
• L-Type Ca2+ Currents Overlapping Threshold Na+ Currents: Could They Be Responsible for the “Slip-Mode” Phenomenon in Cardiac Myocytes?

  2002cited by this paper
• The b1 Subunit but not the b2 Subunit Colocalizes with the Human Heart Na+ Channel (hH1) already within the Endoplasmic Reticulum

  2002influential reference
• Modulation of sodium channels in primary afferent neurons.

  2002cited by this paper
• NaN/Nav1.9: a sodium channel with unique properties.

  2002cited by this paper
• Molecular characterization of voltage-gated sodium channels in human gliomas

  2002cited by this paper
• Evolution of voltage-gated Na(+) channels.

  2002cited by this paper
• Mutations of voltage-gated sodium channels in movement disorders and epilepsy.

  2002cited by this paper
• Voltage-gated sodium channel expression in human breast cancer cells: possible functional role in metastasis.

  2002influential reference
• Interaction of the Nav1.2a Subunit of the Voltage-dependent Sodium Channel with Nodal AnkyrinG

  2002influential reference
• Structural Requirements for Interaction of Sodium Channel β1 Subunits with Ankyrin*

  2002cited by this paper
• Mouse heart Na+ channels: primary structure and function of two isoforms and alternatively spliced variants.

  2002influential reference
• Structure of the sodium channel gene SCN11A

  2002cited by this paper
• βIV-spectrin regulates sodium channel clustering through ankyrin-G at axon initial segments and nodes of Ranvier

  2002cited by this paper
• Alternative Splicing of an Insect Sodium Channel Gene Generates Pharmacologically Distinct Sodium Channels

  2002cited by this paper
• Functional and Biochemical Analysis of a Sodium Channel β1 Subunit Mutation Responsible for Generalized Epilepsy with Febrile Seizures Plus Type 1

  2002cited by this paper
• Molecular mechanism of convergent regulation of brain Na(+) channels by protein kinase C and protein kinase A anchored to AKAP-15.

  2002cited by this paper
• Isoform‐specific effects of sialic acid on voltage‐dependent Na+ channel gating: functional sialic acids are localized to the S5‐S6 loop of domain I

  2002cited by this paper
• Regulation of Voltage‐Dependent Sodium Channel Expression in Adrenal Chromaffin Cells

  2002cited by this paper
• Critical molecular determinants of voltage-gated sodium channel sensitivity to mu-conotoxins GIIIA/B.

  2002cited by this paper
• β subunits: Players in neuronal hyperexcitability?

  2002influential reference
• Reduced sodium channel density, altered voltage dependence of inactivation, and increased susceptibility to seizures in mice lacking sodium channel β2-subunits

  2002cited by this paper
• Critical Molecular Determinants of Voltage-Gated Sodium Channel Sensitivity to μ-Conotoxins GIIIA/B

  2002cited by this paper
• The Human Heart and Rat Brain IIA Na+ Channels Interact with Different Molecular Regions of the β1 Subunit

  2002cited by this paper
• Structural requirements for interaction of sodium channel beta 1 subunits with ankyrin.

  2002cited by this paper
• Ankyrin-G coordinates assembly of the spectrin-based membrane skeleton, voltage-gated sodium channels, and L1 CAMs at Purkinje neuron initial segments

  2001cited by this paper
• Glycosylation Alters Steady-State Inactivation of Sodium Channel Nav1.9/NaN in Dorsal Root Ganglion Neurons and Is Developmentally Regulated

  2001influential reference
• The intracellular segment of the sodium channel beta 1 subunit is required for its efficient association with the channel alpha subunit.

  2001cited by this paper
• Sodium channel β1 and β3 subunits associate with neurofascin through their extracellular immunoglobulin-like domain

  2001cited by this paper
• A CaMK IV responsive RNA element mediates depolarization-induced alternative splicing of ion channels

  2001cited by this paper
• A Prokaryotic Voltage-Gated Sodium Channel

  2001cited by this paper
• A single residue differentiates between human cardiac and skeletal muscle Na+ channel slow inactivation.

  2001cited by this paper
• Compact myelin dictates the differential targeting of two sodium channel isoforms in the same axon.

  2001cited by this paper
• Directional movement of rat prostate cancer cells in direct-current electric field: involvement of voltagegated Na+ channel activity.

  2001cited by this paper
• Contactin Associates with Na+ Channels and Increases Their Functional Expression

  2001cited by this paper
• Implication of the C-Terminal Region of the α-Subunit of Voltage-gated Sodium Channels in Fast Inactivation

  2001cited by this paper
• The intracellular segment of the sodium channel β1 subunit is required for its efficient association with the channel α subunit

  2001cited by this paper
• Transcriptional channelopathies: An emerging class of disorders

  2001influential reference
• Genetic and epigenetic control of the Na‐G ion channel expression in glia

  2001influential reference
• Nr-CAM and neurofascin interactions regulate ankyrin G and sodium channel clustering at the node of Ranvier.

  2001cited by this paper
• Gating Properties of Nav1.7 and Nav1.8 Peripheral Nerve Sodium Channels

  2001cited by this paper
• The Selectivity Filter of the Voltage-gated Sodium Channel Is Involved in Channel Activation*

  2001cited by this paper
• Role of Sodium Channel Deglycosylation in the Genesis of Cardiac Arrhythmias in Heart Failure*

  2001cited by this paper
• Neuromodulation of Na+ channels: An unexpected form of cellular platicity

  2001cited by this paper
• Resurgence of sodium channel research.

  2001cited by this paper
• Identification of a novel voltage-gated Na+ channel rNav1.5a in the rat hippocampal progenitor stem cell line HiB5

  2001cited by this paper
• Direct Interaction with Contactin Targets Voltage-gated Sodium Channel Nav1.9/NaN to the Cell Membrane*

  2001cited by this paper
• Human embryonic genes re-expressed in cancer cells

  2001cited by this paper
• Alternative splicing of potassium channels: a dynamic switch of cellular excitability.

  2001cited by this paper
• Expression profiles of voltage‐gated Na+ channel α‐subunit genes in rat and human prostate cancer cell lines

  2001influential reference
• Channel cytoplasmic loops alter voltage‐dependent sodium channel activation in an isoform‐specific manner

  2001cited by this paper
• Tissue distribution and functional expression of the human voltage-gated sodium channel beta3 subunit.

  2001cited by this paper
• Acquired channelopathies in nerve injury and MS

  2001influential reference
• Glial-Derived Neurotrophic Factor Upregulates Expression of Functional SNS and NaN Sodium Channels and Their Currents in Axotomized Dorsal Root Ganglion Neurons

  2000cited by this paper
• A sodium channel signaling complex: modulation by associated receptor protein tyrosine phosphatase β

  2000cited by this paper
• The neuron as a dynamic electrogenic machine: modulation of sodium-channel expression as a basis for functional plasticity in neurons.

  2000influential reference
• Clustering of sodium channels at the neuromuscular junction

  2000cited by this paper
• Tissue distribution and functional expression of the human voltage-gated sodium channel β3 subunit

  2000cited by this paper
• Direct interaction between synaptotagmin and the intracellular loop I-II of neuronal voltage-sensitive sodium channels.

  2000cited by this paper
• Sodium Channel β Subunits Mediate Homophilic Cell Adhesion and Recruit Ankyrin to Points of Cell-Cell Contact*

  2000cited by this paper
• The Co-repressor mSin3A Is a Functional Component of the REST-CoREST Repressor Complex*

  2000cited by this paper
• Sodium channels and their genes: dynamic expression in the normal nervous system, dysregulation in disease states(1).

  2000cited by this paper
• Regulation of the cardiac voltage‐gated Na+ channel (H1) by the ubiquitin‐protein ligase Nedd4

  2000cited by this paper
• Distinction among Neuronal Subtypes of Voltage-Activated Sodium Channels by μ-Conotoxin PIIIA

  2000cited by this paper
• Novel interaction of the voltage-dependent sodium channel (VDSC) with calmodulin: does VDSC acquire calmodulin-mediated Ca2+-sensitivity?

  2000cited by this paper
• Identification of a novel human voltage-gated sodium channel alpha subunit gene, SCN12A.

  2000cited by this paper

• The local anesthetic, lidocaine, suppresses the growth of colon cancer SW480 cells by decreasing the voltage-gated sodium channel subunit Nav1.5

  2025cites this paper
• Modulation of immune-inflammatory response induced by Klebsiella pneumoniae infection: effect of the AahII toxin from Androctonus australis hector

  2025cites this paper
• MiR-30b-5p alleviates trigeminal neuralgia induced by chronic constriction injury of the infraorbital nerve by regulating the voltage-gated sodium channel Nav1.3 in rats.

  2025cites this paper
• Blocking the voltage‐gated sodium channel hNav1.5 as a novel pH‐dependent mechanism of action for tamoxifen

  2025cites this paper
• Lidocaine Inhibits Rat Prostate Cancer Cell Invasiveness and Voltage-Gated Sodium Channel Expression in Plasma Membrane

  2024cites this paper
• Sodium channels in non-excitable cells: powerful actions and therapeutic targets beyond Hodgkin and Huxley.

  2024cites this paper
• Electrical excitability of cancer cells—CELEX model updated

  2024cites this paper
• Tetracaine downregulates matrix metalloproteinase activity and inhibits invasiveness of strongly metastatic MDA-MB-231 human breast cancer cells.

  2023cites this paper
• Voltage-Sensitive Optical Probes for Measuring Cell Membrane Potentials: An Update and Applications to “Nonexcitable” Cells

  2023cites this paper
• AQP4 Aggravates Cognitive Impairment in Sepsis‐Associated Encephalopathy through Inhibiting Nav1.6‐Mediated Astrocyte Autophagy

  2023cites this paper
• Discovering the Triad between Nav1.5, Breast Cancer, and the Immune System: A Fundamental Review and Future Perspectives

  2022cites this paper
• Oleamide, a Sleep-Inducing Compound: Effects on Ion Channels and Cancer

  2022cites this paper
• Invasion and Metastasis Suppression by Anti-Neonatal Nav1.5 Antibodies in Breast Cancer

  2022cites this paper
• Local Anesthetics via Multicomponent Reactions

  2022cites this paper
• SCN5A promotes the growth and lung metastasis of triple-negative breast cancer through EF2-kinase signaling.

  2022cites this paper
• The relationship between miRNA-210 and SCN1B in fetal rats with hypoxic-ischemic brain injury

  2022cites this paper
• Maturation of hiPSC-derived cardiomyocytes promotes adult alternative splicing of SCN5A and reveals changes in sodium current associated with cardiac arrhythmia

  2022cites this paper
• Neonatal NaV1.5 channels: pharmacological distinctiveness of a cancer‐related voltage‐gated sodium channel splice variant

  2021cites this paper
• Scorpion venom heat‐resistant synthesized peptide ameliorates 6‐OHDA‐induced neurotoxicity and neuroinflammation: likely role of Nav1.6 inhibition in microglia

  2021cites this paper
• Voltage-Gated Sodium Channel β1 Gene: An Overview

  2021cites this paper
• Developmental dynamics of voltage-gated sodium channel isoform expression in the human and mouse brain

  2021cites this paper
• Alternative splicing potentiates dysfunction of early-onset epileptic encephalopathy SCN2A variants

  2020cites this paper
• Exploring the Therapeutic Potential of Membrane Transport Proteins: Focus on Cancer and Chemoresistance

  2020cites this paper
• Developmental dynamics of voltage-gated sodium channel isoform expression in the human and mouse neocortex

  2020cites this paper
• Ion Channels and Transporters as Cancer Biomarkers and Targets for Diagnostics with Antibodies

  2019cites this paper
• Cationic Modulation of Voltage-Gated Sodium Channel (Nav1.5): Neonatal Versus Adult Splice Variants—2. Divalent (Cd2+) and Trivalent (Gd3+) Ions

  2019cites this paper
• Cationic Modulation of Voltage-Gated Sodium Channel (Nav1.5): Neonatal Versus Adult Splice Variants—1. Monovalent (H+) Ions

  2019cites this paper
• Scorpion Venom Analgesic Peptide, BmK AGAP Inhibits Stemness, and Epithelial-Mesenchymal Transition by Down-Regulating PTX3 in Breast Cancer

  2019cites this paper
• Local Anesthetics

  2019cites this paper
• Extracellular waveforms reveal an axonal origin of spikelets in pyramidal neurons.

  2018cites this paper
• This is an author produced version of Nerve growth factor enhances voltage-gated Na+ channel activity and transwell migration in Mat-LyLu rat prostate cancer cell line. White Rose Research Online URL for this paper: http://eprints.whiterose.ac.uk/78725/ Article: Brackenbury, William J. orcid.org/000

  2018cites this paper
• Naringenin inhibits prostate cancer metastasis by blocking voltage-gated sodium channels.

  2018cites this paper
• Multiple sclerosis and non-dystrophic myotonias: do they share a common pathophysiology?

  2018cites this paper
• The influence of sodium on pathophysiology of multiple sclerosis

  2017cites this paper
• State-dependent block of voltage-gated sodium channels by the casein-kinase 1 inhibitor IC261

  2017cites this paper
• Distribution and function of voltage-gated sodium channels in the nervous system

  2017cites this paper
• Intracellular calcium oscillations in strongly metastatic human breast and prostate cancer cells: control by voltage-gated sodium channel activity

  2016cites this paper
• Anti-angiogenic activities of CRBGP from buccal glands of lampreys (Lampetra japonica).

  2016cites this paper
• Recent Trends in the Discovery of Small Molecule Blockers of Sodium Channels.

  2016cites this paper
• Identification and Characterization of ProTx-III [μ-TRTX-Tp1a], a New Voltage-Gated Sodium Channel Inhibitor from Venom of the Tarantula Thrixopelma pruriens

  2015cites this paper
• Dual roles of voltage-gated sodium channels in development and cancer.

  2015cites this paper
• by Toggling an Amino Acid in the First S3-S4 Linker Alternative Splicing Modulates Inactivation of Type 1 Voltage-gated Sodium Channels

  2015cites this paper
• Ion channel expression as promising cancer biomarker.

  2015cites this paper
• Expression of neonatal Nav1.5 in human brain astrocytoma and its effect on proliferation, invasion and apoptosis of astrocytoma cells.

  2014cites this paper
• Regulation of voltage-gated sodium channel expression in cancer: hormones, growth factors and auto-regulation

  2014cites this paper
• The small GTPase RhoA regulates the expression and function of the sodium channel Nav1.5 in breast cancer cells.

  2014cites this paper
• Membrane potential and cancer progression

  2013cites this paper
• Nav1.5 sodium channels in macrophages in multiple sclerosis lesions

  2013cites this paper
• The cardiac sodium current Na(v)1.5 is functionally expressed in rabbit bronchial smooth muscle cells.

  2013cites this paper
• Expression profiling of ion channel genes predicts clinical outcome in breast cancer

  2013cites this paper
• Transmembrane voltage potential is an essential cellular parameter for the detection and control of tumor development in a Xenopus model

  2013cites this paper
• The role of voltage-gated sodium channels in non-small cell lung cancer

  2013cites this paper
• The sigma-1 receptor: a regulator of cancer cell electrical plasticity?

  2013cites this paper
• Bifurcation Analysis of Nociceptive Neurons

  2013cites this paper
• Ovarian cancer: Ion channel and aquaporin expression as novel targets of clinical potential.

  2013cites this paper
• Noncanonical roles of voltage-gated sodium channels.

  2013cites this paper
• Chaotic Attractors of Control Systems

  2012cites this paper
• Pacemaker Rate and Depolarization Block in Nigral Dopamine Neurons: A Somatic Sodium Channel Balancing Act

  2012cites this paper
• Oxidative Stress in the in vivo DMBA Rat Model of Breast Cancer: Suppression by a Voltage‐gated Sodium Channel Inhibitor (RS100642)

  2012cites this paper
• Neurological perspectives on voltage-gated sodium channels

  2012cites this paper
• A Theory of Rate Coding Control by Intrinsic Plasticity Effects

  2012cites this paper
• Voltage-gated sodium channels and metastatic disease

  2012cites this paper
• Identification of novel NaV1.7 antagonists using high throughput screening platforms.

  2012cites this paper
• Overexpression of the VSSC‐associated CAM, beta‐2, enhances LNCaP cell metastasis associated behavior

  2012cites this paper
• Voltage‐Gated Sodium Channels as Therapeutic Targets

  2012cites this paper
• Sodium channels and microglial function.

  2012cites this paper
• Role of ion channels and transporters in cell migration.

  2012cites this paper
• Persistent current blockers of voltage-gated sodium channels: a clinical opportunity for controlling metastatic disease.

  2012cites this paper
• Studies of ionic mechanisms associated with human cancers

  2012cites this paper
• Upregulated expression of voltage-gated sodium channel Nav1.3 in cortical lesions of patients with focal cortical dysplasia type IIb

  2012cites this paper
• IMPACT OF SECRETASES ON METASTATIC BEHAVIOR OF PROSTATE CANCER CELLS IN VITRO

  2012cites this paper
• Ion channels as targets for cancer therapy.

  2011cites this paper
• Overexpression of NaV1.6 channels is associated with the invasion capacity of human cervical cancer

  2011cites this paper
• Association of NaV1.8 with lipid rafts in DRG sensory neurons

  2011cites this paper
• SCN1A splice variants exhibit divergent sensitivity to commonly used antiepileptic drugs

  2011cites this paper
• Analgesic‐antitumor peptide inhibits proliferation and migration of SHG‐44 human malignant glioma cells

  2011cites this paper
• CTGTAGCTCGTGTTGTATCGCCGTTAATAAGGATGGAAAGTTTGAGGTTG GCTGTACGAAGATGAGAAGTGGTGGATAATGGAGAGTGAGGAGGATGAGG CTTCTCATCCCAATCAGACTGTATCTTCTTCCCTACGGCTTCTCAAACTC TCACTCGTCCTCTGGGCTGAGATCAACATCTAATTTATGTAAGGGTGTGG AATATCGTACAATAGTTAGTAACGTGGAGGGCGACATCTTTGCACTTCTG CCTGTAGATAATCACTCCTCATTCTTTGGACGTTAAGGAACCAAG

  2011cites this paper
• Alternative splicing in SCN1A : biophysical consequences for NaV1.1 channels

  2011influential citation
• Microarray-detected changes in gene expression in gills of green crabs (Carcinus maenas) upon dilution of environmental salinity.

  2011cites this paper
• Beneficial effects of omega-3 long-chain fatty acids in breast cancer and cardiovascular diseases: voltage-gated sodium channels as a common feature?

  2011cites this paper
• Neuronal differentiation by indomethacin and IBMX inhibits proliferation of small cell lung cancer cells in vitro.

  2011cites this paper
• Subthreshold membrane conductances enhance directional selectivity in vertebrate sensory neurons.

  2010cites this paper
• New Trends in Cancer Therapy: Targeting Ion Channels and Transporters

  2010cites this paper
• Expression of voltage-gated sodium channel alpha subunit in human ovarian cancer.

  2010cites this paper
• Protein kinase A and regulation of neonatal Nav1.5 expression in human breast cancer cells: activity-dependent positive feedback and cellular migration.

  2010cites this paper
• Alternative Promoter Usage and Splicing of the Human SCN5A Gene Contribute to Transcript Heterogeneity

  2010cites this paper
• Physical and functional interaction between integrins and hERG1 channels in cancer cells.

  2010cites this paper
• Gene-family profiling: a normalization-free real-time RT-PCR approach with increased physiological resolution.

  2010cites this paper
• Integrins and ion channels in cell migration: implications for neuronal development, wound healing and metastatic spread.

  2010cites this paper
• Studies of ionic mechanisms in model cell lines of prostate cancer

  2010influential citation
• Healing and Metastatic Spread

  2010cites this paper
• Cyclic polyether phycotoxins in vitro studies: effects of yessotoxin on a primary culture of rat cardiomyocytes-comparison of ciguatoxins and brevetoxins potency on human VGSC of brain and peripheral sensory neurons expressed in HEK293 cells

  2010cites this paper
• Caracterização e diferenciação neural in vitro de células-tronco de polpa de dente decíduo humano

  2009cites this paper
• SMALL CONDUCTANCE CALCIUM-ACTIVATED POTASSIUM (SK) CHANNELS IN MAMMALIAN SPINAL MOTONEURONS

  2009cites this paper
• Protein-protein interactions involving voltage-gated sodium channels: Post-translational regulation, intracellular trafficking and functional expression.

  2009cites this paper
• Voltage-gated sodium channel blockers for the treatment of chronic pain.

  2009cites this paper
• Reactive Nitrogen Species: Molecular Mechanisms and Potential Significance in Health and Disease

  2009cites this paper
• Molecular pharmacology of voltage-gated sodium channel expression in metastatic disease: clinical potential of neonatal Nav1.5 in breast cancer.

  2009cites this paper
• Sodium channel activity modulates multiple functions in microglia

  2009cites this paper
• Targeting ion channels in cancer: a novel frontier in antineoplastic therapy.

  2009cites this paper