A gene for maturity onset diabetes of the young (MODY) maps to chromosome 12q

No abstract is available for this paper.

• Publication year

  1995

• Venue

  Nature Genetics

• Publication date

  1995-04-01

• Fields of study

  Biology, Medicine

• Identifiers
  DOI 10.1038/NG0495-418PMID 7795649
• External record

  Open on Semantic Scholar

• Source metadata

  Semantic Scholar, PubMed

• No claims are published for this paper.

• No concepts are published for this paper.

• Abnormal Insulin Secretion, Not Insulin Resistance, Is the Genetic or Primary Defect of MODY in the RW Pedigree

  1994cited by this paper
• Search for a Third Susceptibility Gene for Maturity-Onset Diabetes of the Young: Studies With Eleven Candidate Genes

  1994cited by this paper
• Glucokinase mutations associated with non-insulin-dependent (type 2) diabetes mellitus have decreased enzymatic activity: implications for structure/function relationships.

  1993cited by this paper
• Familial hyperglycemia due to mutations in glucokinase. Definition of a subtype of diabetes mellitus.

  1993cited by this paper
• A second-generation linkage map of the human genome

  1992cited by this paper
• Close linkage of glucokinase locus on chromosome 7p to early-onset non-insulin-dependent diabetes mellitus

  1992cited by this paper
• A comprehensive genetic linkage map of the human genome. NIH/CEPH Collaborative Mapping Group.

  1992cited by this paper
• Primary pancreatic beta-cell secretory defect caused by mutations in glucokinase gene in kindreds of maturity onset diabetes of the young.

  1992cited by this paper
• A comprehensive genetic linkage map of the human genome. NIH/CEPH Collaborative Mapping Group.

  1992cited by this paper
• Gene for non-insulin-dependent diabetes mellitus (maturity-onset diabetes of the young subtype) is linked to DNA polymorphism on human chromosome 20q.

  1991cited by this paper
• Strategies for the collection of sibling-pair data for genetic studies in Type 2 (non-insulin-dependent) diabetes mellitus

  1991cited by this paper
• Scope and Heterogeneous Nature of MODY

  1990cited by this paper
• Human genetic diseases : a practical approach

  1986cited by this paper
• Easy calculations of lod scores and genetic risks on small computers.

  1984cited by this paper
• STATISTICAL METHODS

  1967cited by this paper
• Extension of multiple range tests to group means with unequal numbers of replications

  1956cited by this paper

• Review Article: Overview of Clinical Genetics of Diabetes Mellitus.

  2026cites this paper
• In-utero exposure to maternal diabetes and DNA methylation alterations in the Next Generation birth cohort

  2025cites this paper
• Management of pregnancy in women with monogenic diabetes due to mutations in GCK, HNF1A and HNF4A genes

  2024cites this paper
• Genomic and Transcriptomic Profile of HNF1A-Mutated Liver Adenomas Highlights Molecular Signature and Potential Therapeutic Implications

  2024cites this paper
• Analysing Health Professionals' Adherence to National Guidelines and Comparing Diabetes Care in Specialized Care Centres and Hospitals

  2024cites this paper
• HNF1ɑ promotes colorectal cancer progression via HKDC1-mediated activation of AKT/AMPK signaling pathway.

  2024cites this paper
• Animal Models of Pancreas Development, Developmental Disorders, and Disease.

  2020cites this paper
• INVESTIGATION OF THE CONTRIBUTION OF GENETIC VARIANTS ON THE DEVELOPMENT OF OBESITY AND METABOLIC COMPLICATIONS IN A MULTI-ETHNIC CONTEXT

  2019cites this paper
• Hepatic Nuclear Factor 1 Alpha (HNF-1α) in Human Physiology and Molecular Medicine.

  2019cites this paper
• Rapid Publication Characterization of the MODY 3 Phenotype Early-Onset Diabetes Caused by an Insulin Secretion Defect

  2018cites this paper
• Monogenic disorders of glucose-stimulated insulin secretion: massively parallel sequencing approaches

  2018cites this paper
• Genotype-based personalized correction of glycemic control in patients with MODY due to mutations in GCK, HNF1A AND HNF4A genes

  2017cites this paper
• Serum Proteome Analysis of Catatonia

  2017cites this paper
• Understanding the Importance of Gene and Environment in the Etiology and Prevention of Type 2 Diabetes Mellitus in High-Risk Populations

  2016cites this paper
• Monogenic diabetes: Implementation of translational genomic research towards precision medicine

  2016influential citation
• Historical Overview of Gene Discovery Methodologies in Type 2 Diabetes

  2016cites this paper
• Type 2 Diabetes: Geriatric Considerations

  2016cites this paper
• Drug-Induced Hyperglycemia and Diabetes Mellitus

  2016cites this paper
• Genetic markers of inflammation may not contribute to metabolic traits in Mexican children

  2016cites this paper
• Pharmacogenetics and Metabolic Disease

  2016cites this paper
• When is it MODY? Challenges in the Interpretation of Sequence Variants in MODY Genes.

  2015cites this paper
• SUPEREXPRESSÃO DE Slc2a2/GLUT2 INDUZIDA POR ALTA CONCENTRAÇÃO DE GLICOSE EM CÉLULAS TUBULARES RENAIS IRPTC ENVOLVE ATIVAÇÃO DE HNF4A E FOXA2 MEDIADA POR AKT

  2015cites this paper
• Rare and common genetic events in type 2 diabetes: what should biologists know?

  2015cites this paper
• MODY3 in the children and adolescents: the molecular-genetic basis and clinico-laboratory manifestations

  2015cites this paper
• Superexpressão de Slc2a2/GLUT2 induzida por alta concentração de glicosse em células tubulares renais IRPTC envolve ativação de HNF4A e FOXA2 mediada por AKT

  2015cites this paper
• Role of the type II diabetes-associated gene SLC30A8 in the pancreatic α-cell

  2015cites this paper
• Exploring the Genomic Roadmap and Molecular Phylogenetics Associated with MODY Cascades Using Computational Biology

  2014cites this paper
• Type 2 diabetes susceptibility gene variants predispose to adult-onset autoimmune diabetes

  2014cites this paper
• Early-Onset Type 2 Diabetes Mellitus Is Associated to HNF4A T130I Polymorphism in Families of Central Spain

  2014cites this paper
• Mutations in the Genes Encoding the Transcription Factors Hepatocyte Nuclear Factor 1 Alpha and 4 Alpha in Maturity‐Onset Diabetes of the Young and Hyperinsulinemic Hypoglycemia

  2013cites this paper
• Carbohydrate-Responsive Element Binding Protein

  2013cites this paper
• LANDSCAPE OF MONOGENIC DIABETES IN THE THIRD MILLENIUM

  2013cites this paper
• Title Inference of gene-phenotype associations via protein-proteininteraction and orthology

  2013cites this paper
• Inference of Gene-Phenotype Associations via Protein-Protein Interaction and Orthology

  2013cites this paper
• Whole-Exome Sequencing and High Throughput Genotyping Identified KCNJ11 as the Thirteenth MODY Gene

  2012cites this paper
• Review of Insulin and its Analogues in Diabetes Mellitus

  2012cites this paper
• The endocrine pancreas: insights into development, differentiation, and diabetes

  2012cites this paper
• Search for Susceptibility Genes in Osteoarthritis

  2012cites this paper
• 境界型の時期から10年以上の臨床経過を追えたcommon mutation（HNF1A/P291fsinsC）を有するMODY3の1例

  2012cites this paper
• Importance of clinical variables in the diagnosis of MODY2 and MODY3.

  2011cites this paper
• Original articleImportance of clinical variables in the diagnosis of MODY2 and MODY3Importancia de las variables clínicas en el diagnóstico de MODY2 y MODY3

  2011cites this paper
• O diabetes altera a expressão do RNAm do GLUT2 em fígado e rim: participação dos fatores transcricionais Hepatic Nuclear Factor - (HNF-) 1a, 3b e 4a.

  2011cites this paper
• Evaluation of specific genotypes in the context of the type 2 diabetes risk phenotype in the black South African population

  2010cites this paper
• Clinical differences between patients with MODY-3, MODY-2 and type 2 diabetes mellitus with I27L polymorphism in the HNF1alpha gene.

  2010cites this paper
• The Genetics of Type 2 Diabetes: From Candidate Gene Biology to Genome‐Wide Studies

  2010cites this paper
• Genes and type 2 diabetes: polymorphisms of the EIF2AK3 gene and its relationship to type 2 diabetes mellitus

  2010cites this paper
• The molecular basis and clinical characteristics of Maternally Inherited Diabetes and Deafness (MIDD), a recently recognized diabetic subtype.

  2009cites this paper
• Carbohydrate-Responsive Element-Binding Protein (ChREBP) Is a Negative Regulator of ARNT/HIF-1β Gene Expression in Pancreatic Islet β-Cells

  2009cites this paper
• Hnf1α (MODY3) Controls Tissue-Specific Transcriptional Programs and Exerts Opposed Effects on Cell Growth in Pancreatic Islets and Liver

  2009cites this paper
• Gene Mapping in the 20th and 21st Centuries: Statistical Methods, Data Analysis, and Experimental Design

  2009cites this paper
• Gene Mapping in the 20th and 21st Centuries: Statistical Methods, Data Analysis, and Experimental Design

  2009cites this paper
• Hepatocyte nuclear factor 1-alpha mutation in normal glucose-tolerant subjects and early-onset type 2 diabetic patients

  2008cites this paper
• Genetics of Type 2 Diabetes and Metabolic Syndrome: From Genome Wide Linkage Scan and Candidate Genes to Genome Wide Association Studies

  2008cites this paper
• Analysis of heterogeneity and epistasis in physiological mixed populations by combined structural equation modelling and latent class analysis

  2008cites this paper
• Problems in differential diagnosis of diabetes types.

  2008cites this paper
• The effects of resistance training on individuals with clusters of metabolic risk factors : focus on functional capacities, clinical outcomes and quality of life

  2008cites this paper
• TGGCCGTGAGCATCCTCTGCC CGTGGCCCTGTGGCAGCCGA CCCTTGCTGAGCAGATCCCGTC GCAAGGTCAGGGGAATGGAC GGCTCATGGGTGGCTATTTCTGC TGCTGAGGCAGGACACTGCTTC CCCGGACACAGCTTGGCTTCC CAGGCCTGGCCTCCACGCAG GGCCCAGTACACCCACACGGG GGCCCAGTACACCCACACGGG GCCTTGTTTGCCTCTGCAGTG GCGTGGGTTGCGTTTGCCTGC GGGCTCGTTAGGAGCTGAGGG GGGATGGTGAAGC

  2008cites this paper
• Monogenic Forms of Diabetes in the Young

  2008cites this paper
• Monogenic diabetes in the young, pharmacogenetics and relevance to multifactorial forms of type 2 diabetes.

  2008cites this paper
• Distinct roles of HNF1beta, HNF1alpha, and HNF4alpha in regulating pancreas development, beta-cell function and growth.

  2007cites this paper
• Analysis of the GCK and HNF-1α Gene Polymorphism in Korean Type 2 Diabetic Patients by PCR-DHPLC

  2007cites this paper
• Distinct Roles of HNF1 Β , HNF1 α , and HNF4 α in Regulating Pancreas Development, Β -Cell Function and Growth

  2007cites this paper
• Diabetic neuropathy: pathogenesis and treatment.

  2007cites this paper
• Rozbudowywanie podziału cukrzycy - nowe podtypy i możliwości lecznicze

  2007influential citation
• Defining the genetic aetiology of monogenic diabetes can improve treatment

  2006cites this paper
• Mutations in the genes encoding the transcription factors hepatocyte nuclear factor 1 alpha (HNF1A) and 4 alpha (HNF4A) in maturity‐onset diabetes of the young

  2006cites this paper
• A hepatocyte nuclear factor-4 alpha gene (HNF4A) P2 promoter haplotype linked with late-onset diabetes: studies of HNF4A variants in the Norwegian MODY registry.

  2006cites this paper
• Family history and pedigree charting--a simple genetic tool for Indian diabetics.

  2006cites this paper
• Genetic basis of maturity-onset diabetes of the young.

  2006cites this paper
• Cyclooxygenase expression in human diabetes

  2006cites this paper
• Mutations in the CEL VNTR cause a syndrome of diabetes and pancreatic exocrine dysfunction

  2006cites this paper
• Regulation der Entwicklung des Pankreas

  2006cites this paper
• A Hepatocyte Nuclear Factor-4α Gene (HNF4A) P2 Promoter Haplotype Linked With Late-Onset Diabetes

  2006cites this paper
• Diabetes mellitus and its treatment

  2005cites this paper
• Type 2 diabetes mellitus: from genes to disease.

  2005influential citation
• Typ-2-Diabetes-mellitus — eine durch die Umwelt modifizierbare Erbkrankheit

  2005cites this paper
• Genetics of type 2 diabetes mellitus.

  2005cites this paper
• Genetics of Type 2 diabetes

  2005cites this paper
• Searching for genes in diabetes and the metabolic syndrome

  2004cites this paper
• Diabetes tipo MODY MODY: una "transcriptopatía" de las células pancreáticas. Biología molecular y aplicaciones terapéuticas futuras

  2004cites this paper
• The future of genetic testing for drug response

  2004cites this paper
• The Prevalence of Maturity Onset Diabetes of the Young(MODY) 3 in Children with Type 2 Diabetes Mellitus

  2004cites this paper
• The emergence of type 2 diabetes in childhood

  2004cites this paper
• Genetic Basis of Type 2 Diabetes Mellitus Implications for Therapy

  2004cites this paper
• Polymorphism of the Hepatocyte Nuclear Factor-1 Gene in the Early-onset of Type 2 Diabetes Mellitus with a Strong Family History in Korea

  2004cites this paper
• Identification of a locus for maturity-onset diabetes of the young on chromosome 8p23.

  2004influential citation
• Diabetes mellitus as the presenting feature of extrahepatic cholangiocarcinoma in situ: case report and review of literature.

  2004cites this paper
• Transcription factor 1 and β‐cell function in glucose‐tolerant subjects

  2003cites this paper
• Raport Komisji Ekspertów na temat Rozpoznawania i Klasyfikacji Cukrzycy

  2003cites this paper
• A genome-wide scan in families with maturity-onset diabetes of the young: evidence for further genetic heterogeneity.

  2003influential citation
• A meta-analysis of four European genome screens (GIFT Consortium) shows evidence for a novel region on chromosome 17p11.2-q22 linked to type 2 diabetes.

  2003cites this paper
• Diagnosis and Management of Diabetes in Children

  2003cites this paper
• Genetic variation at the scavenger receptor class B type I gene locus determines plasma lipoprotein concentrations and particle size and interacts with type 2 diabetes: the framingham study.

  2003cites this paper
• Genome scans in endocrinological diseases

  2003cites this paper
• [Maturity-onset diabetes of the young (MODY): the history of its dismemberment].

  2003cites this paper
• The inherited basis of diabetes mellitus: implications for the genetic analysis of complex traits.

  2003cites this paper
• Genome Scans of Type 2 Diabetes Mellitus

  2003cites this paper
• The search for type 2 diabetes genes.

  2003cites this paper
• Effects of Leptin to Cultured Growth Plate Chondrocytes

  2003cites this paper
• A search for candidate genes for lipodystrophy, obesity and diabetes via gene expression analysis of A-ZIP/F-1 mice.

  2003cites this paper