Glucose-regulated protein 78 as a novel effector of BRCA1 for inhibiting stress-induced apoptosis

No abstract is available for this paper.

• Publication year

  2008

• Venue

  Oncogene

• Publication date

  2008-11-13

• Fields of study

  Biology, Medicine

• Identifiers
  DOI 10.1038/onc.2008.290PMID 18776923
• External record

  Open on Semantic Scholar

• Source metadata

  Semantic Scholar, PubMed

• No claims are published for this paper.

• No concepts are published for this paper.

• GRP78 induction in cancer: therapeutic and prognostic implications.

  2007cited by this paper
• The ER chaperone and signaling regulator GRP78/BiP as a monitor of endoplasmic reticulum stress.

  2005cited by this paper
• Proteomic analysis of a preneoplastic phenotype in ovarian surface epithelial cells derived from prophylactic oophorectomies.

  2005cited by this paper
• BRCA1 participates in DNA decatenation

  2005cited by this paper
• ATF6 modulates SREBP2‐mediated lipogenesis

  2004cited by this paper
• Overexpression of the glucose-regulated stress gene GRP78 in malignant but not benign human breast lesions

  2004cited by this paper
• The Unfolded Protein Response Is Required for Haploid Tolerance in Yeast*

  2003cited by this paper
• Role of BRCA1 in heat shock response

  2003cited by this paper
• Role of BRCA1 in cellular resistance to paclitaxel and ionizing radiation in an ovarian cancer cell line carrying a defective BRCA1

  2003cited by this paper
• Endoplasmic Reticulum Chaperone Protein GRP78 Protects Cells from Apoptosis Induced by Topoisomerase Inhibitors

  2003cited by this paper
• Global Profiling of the Cell Surface Proteome of Cancer Cells Uncovers an Abundance of Proteins with Chaperone Function*

  2003cited by this paper
• Activation of the E3 ligase function of the BRCA1/BARD1 complex by polyubiquitin chains

  2002cited by this paper
• BRCA1 and BRCA2 and the genetics of breast and ovarian cancer.

  2001cited by this paper
• Genetic interactions between tumor suppressors Brca1 and p53 in apoptosis, cell cycle and tumorigenesis

  2001cited by this paper
• Reduction of BRCA1 expression in sporadic ovarian cancer.

  2000cited by this paper
• BRCA1 Facilitates Stress-induced Apoptosis in Breast and Ovarian Cancer Cell Lines*

  2000cited by this paper
• Brca1 controls homology-directed DNA repair.

  1999cited by this paper
• Localization of human BRCA1 and its loss in high-grade, non-inherited breast carcinomas

  1999cited by this paper
• BRCA1 required for transcription-coupled repair of oxidative DNA damage.

  1998cited by this paper
• BAP1: a novel ubiquitin hydrolase which binds to the BRCA1 RING finger and enhances BRCA1-mediated cell growth suppression

  1998cited by this paper

• BRCA1 alleviates inflammation, oxidative stress, and ovarian granulosa cell apoptosis by inhibiting endoplasmic reticulum stress, thereby ameliorating polycystic ovary syndrome

  2026cites this paper
• Mechanistic insights and therapeutic potential of glucose-regulated protein 78 in drug-resistant solid tumors: A comprehensive review.

  2026cites this paper
• miR-6126 modulates GRP78 to suppress the Warburg effect and mitochondrial dynamics in triple-negative breast cancer

  2025cites this paper
• BRCA1 is involved in sustaining rapid antler growth possibly via balancing of the p53/endoplasmic reticulum stress signaling pathway

  2025cites this paper
• Emerging mechanisms of the unfolded protein response in therapeutic resistance: from chemotherapy to Immunotherapy

  2024cites this paper
• Recruitment of USP10 by GCS1 to deubiquitinate GRP78 promotes the progression of colorectal cancer via alleviating endoplasmic reticulum stress

  2024cites this paper
• UPR-induced ovarian cancer cell fusion: a mechanism favoring drug resistance?

  2023cites this paper
• BRCA1 mediates protein homeostasis through the ubiquitination of PERK and IRE1

  2022cites this paper
• BRCA mutational status shapes the stromal microenvironment of pancreatic cancer linking clusterin expression in cancer associated fibroblasts with HSF1 signaling

  2022cites this paper
• Current status of sorafenib nanoparticle delivery systems in the treatment of hepatocellular carcinoma

  2021cites this paper
• HSP70s in Breast Cancer: Promoters of Tumorigenesis and Potential Targets/Tools for Therapy

  2021cites this paper
• BRCA mutational status shapes the stromal microenvironment of pancreatic cancer linking CLU+ CAF expression with HSF1 signaling

  2021cites this paper
• Comparative proteomic and transcriptomic analysis reveals high pH–induced expression signatures of Chinese shrimp Fenneropenaeus chinensis

  2021cites this paper
• Cell-type-specific epigenomic variations associated with BRCA1 mutation in pre-cancer human breast tissues

  2020influential citation
• Enhancement of cisplatin sensitivity in human breast cancer MCF-7 cell line through BiP and 14-3-3ζ co-knockdown

  2020cites this paper
• Crosstalk between Endoplasmic Reticulum Stress, Unfolded Protein Response (UPR) and Wnt Signaling Pathway in Cancer

  2020cites this paper
• GALNT6 promotes invasion and metastasis of human lung adenocarcinoma cells through O-glycosylating chaperone protein GRP78

  2020cites this paper
• Evaluation of Endoplasmic Reticulum Stress Mechanism and Unfold Protein Response Signaling in Cancer

  2019cites this paper
• The Regulation of the Unfolded Protein Response and Its Roles in Tumorigenesis and Cancer Therapy

  2019cites this paper
• The onus of cannabinoids in interrupting the molecular odyssey of breast cancer: A critical perspective on UPRER and beyond

  2019cites this paper
• Protective effect of exogenous hydrogen sulfide on pulmonary artery endothelial cells by suppressing endoplasmic reticulum stress in a rat model of chronic obstructive pulmonary disease.

  2018cites this paper
• Alleviation of endoplasmic reticulum stress by tauroursodeoxycholic acid delays senescence of mouse ovarian surface epithelium

  2018cites this paper
• Exosomes derived from siRNA against GRP78 modified bone-marrow-derived mesenchymal stem cells suppress Sorafenib resistance in hepatocellular carcinoma

  2018cites this paper
• Targeting oral cancer stemness and chemoresistance by isoliquiritigenin-mediated GRP78 regulation

  2017cites this paper
• Endoplasmic reticulum stress signaling and chemotherapy resistance in solid cancers

  2017cites this paper
• Mécanismes de relocalisation de la Glucose-regulated protein 78 à la surface des cellules du cancer de l'ovaire

  2016cites this paper
• Cancer-associated fibroblasts promote non-small cell lung cancer cell invasion by upregulation of glucose-regulated protein 78 (GRP78) expression in an integrated bionic microfluidic device

  2016cites this paper
• Functional characterization and proteomic analysis of the nucleocapsid protein of porcine deltacoronavirus

  2015cites this paper
• Cell Surface GRP78 Accelerated Breast Cancer Cell Proliferation and Migration by Activating STAT3

  2015cites this paper
• Duhuo Jisheng decoction inhibits endoplasmic reticulum stress in chondrocytes induced by tunicamycin through the downregulation of miR-34a.

  2015cites this paper
• BRCA1 deficiency induces protective autophagy to mitigate stress and provides a mechanism for BRCA1 haploinsufficiency in tumorigenesis.

  2014cites this paper
• Treatment with Caulerpa Microphysa Pepsin‐Digested Extract Induces Apoptosis in Murine Leukemia WEHI‐3 Cells

  2014cites this paper
• Comparative proteomics analysis of host cells infected with Brucella abortus A19

  2014cites this paper
• The impact of the endoplasmic reticulum protein-folding environment on cancer development

  2014cites this paper
• Endoplasmic reticulum ribosome-binding protein 1 (RRBP1) overexpression is frequently found in lung cancer patients and alleviates intracellular stress-induced apoptosis through the enhancement of GRP78

  2013cites this paper
• Research progress on the relationship between BRCA1 and hereditary breast cancer

  2013cites this paper
• GACGGTCCTCCTGGTCTTTG GTGGCTGGCTGCATTGC CHOP / Gadd 153 AGGAGCCAGGGCCAACA TCTGGAGAGCGAGGGCTTT Bax CCAAGAAGCTGAGCGAGTGTCT AGCTCCATATTGCTGTCCAGTTC Ccna 1 TTTCCCCAATGCTGGTTGA AACCAAAATCCGTTGCTTCCT Ccnb 1 CCCTCGGTGGGATTCAAGT GCCAAGCAAGACATTAAACATCAT Ccnc CAGGACATGGGCCAGGAA CGTCCTGTAGGTATCATTCACTATCC Ccnd

  2012cites this paper
• All-trans-retinoic acid induces short forelimb malformation during mouse embryo development by inhibiting chondrocyte maturation rather than by evoking excess cell death.

  2012cites this paper
• miR-30d, miR-181a and miR-199a-5p cooperatively suppress the endoplasmic reticulum chaperone and signaling regulator GRP78 in cancer

  2012cites this paper
• Le métabolisme des acides gras monoinsaturés et la prolifération des cellules cancéreuses coliques : rôle de la Stéaroyl-CoA Désaturase-1 et effets des isomères conjugués de l'acide linoléique

  2012cites this paper
• Quantitative proteomic analysis and functional studies reveal that nucleophosmin is involved in cell death in glioblastoma cell line transfected with siRNA

  2012cites this paper
• Disturbance of Ca2+ Homeostasis Converts Pro-Met into Non-canonical Tyrosine Kinase p190MetNC in Response to Endoplasmic Reticulum Stress in MHCC97 Cells*

  2012cites this paper
• Targeting endoplasmic reticulum stress for cancer therapy.

  2012cites this paper
• Endoplasmic Reticulum Stress: Its Role in Disease and Novel Prospects for Therapy

  2012cites this paper
• Progression of apoptic signaling from mesenteric ischemia–reperfusion injury to lungs: correlation in the level of ER chaperones expression

  2012cites this paper
• Glucose regulated protein 78: a critical link between tumor microenvironment and cancer hallmarks.

  2012cites this paper
• IGFBP-3 sensitizes antiestrogen-resistant breast cancer cells through interaction with GRP78.

  2012cites this paper
• Overexpression of GRP78 and GRP94 is involved in colorectal carcinogenesis.

  2011cites this paper
• Rol de BRCA1 en la regulación de la transcripción en cáncer de próstata

  2011cites this paper
• Glucose-Regulated Protein 78 Positivity as a Predictor of Poor Survival in Patients with Renal Cell Carcinoma

  2011cites this paper
• BRCA1 Loss Induces GADD153-Mediated Doxorubicin Resistance in Prostate Cancer

  2011cites this paper
• DNA Damage and Cellular Stress Responses BRCA 1 Loss Induces GADD 153-Mediated Doxorubicin Resistance in Prostate Cancer

  2011cites this paper
• Inhibition of Stearoyl-CoA Desaturase 1 Expression Induces CHOP-Dependent Cell Death in Human Cancer Cells

  2010cites this paper
• Identification of candidate biomarkers with cancer‐specific glycosylation in the tissue and serum of endometrioid ovarian cancer patients by glycoproteomic analysis

  2010cites this paper
• WWOX, tumour suppressor and modifier gene, as a regulator of gene expression and apoptosis in ovarian cancer.

  2010cites this paper
• Calcium-mediated Stress Kinase Activation by DMP1 Promotes Osteoblast Differentiation*

  2010cites this paper
• Analysis of changes in pro (Gadd153) and anti apoptotic (Grp78) gene expression after ischemic-reperfusion injury of the small intestine.

  2010cites this paper
• Molecular biomarkers for predicting chemotherapy response in lung cancer.

  2009cites this paper
• Glucose is a key regulator of VEGFR2/KDR in human epithelial ovarian carcinoma cells.

  2009cites this paper