Mobilized Human Hematopoietic Stem/Progenitor Cells Promote Kidney Repair After Ischemia/Reperfusion Injury

No abstract is available for this paper.

• Publication year

  2010

• Venue

  Circulation

• Publication date

  2010-05-25

• Fields of study

  Medicine

• Identifiers
  DOI 10.1161/CIRCULATIONAHA.109.928796PMID 20458011PMCID PMC2919223
• External record

  Open on Semantic Scholar

• Source metadata

  Semantic Scholar, PubMed

• No claims are published for this paper.

• No concepts are published for this paper.

• The Legionella Kinase LegK2 Targets the ARP2/3 Complex To Inhibit Actin Nucleation on Phagosomes and Allow Bacterial Evasion of the Late Endocytic Pathway

  2015cited by this paper
• Epithelial and Mesenchymal Cell Biology Pericytes and Perivascular Fibroblasts Are the Primary Source of Collagen-Producing Cells in Obstructive Fibrosis of the Kidney

  2010cited by this paper
• Fate tracing reveals the pericyte and not epithelial origin of myofibroblasts in kidney fibrosis.

  2010cited by this paper
• Extended In Vitro Expansion of Adult, Mobilized CD34+ Cells Without Significant Cell Senescence Using a Stromal Cell Coculture System with Single Cytokine Support

  2009cited by this paper
• Acute kidney injury increases risk of ESRD among elderly.

  2009cited by this paper
• Autologous and Allogeneic Marrow Stromal Cells Are Safe and Effective for the Treatment of Acute Kidney Injury

  2009cited by this paper
• Reactive oxygen species/oxidative stress contributes to progression of kidney fibrosis following transient ischemic injury in mice.

  2009cited by this paper
• Bone Marrow Ly6Chigh Monocytes Are Selectively Recruited to Injured Kidney and Differentiate into Functionally Distinct Populations1

  2009cited by this paper
• Circulating endothelial/skeletal progenitor cells for bone regeneration and healing.

  2008cited by this paper
• Bone marrow-derived mononuclear cell therapy induces distal angiogenesis after local injection in critical leg ischemia

  2008cited by this paper
• Endothelial progenitor cells: identity defined?

  2008cited by this paper
• Short- and long-term survival after acute kidney injury.

  2008cited by this paper
• Administrations of Peripheral Blood CD34‐Positive Cells Contribute to Medial Collateral Ligament Healing via Vasculogenesis

  2008cited by this paper
• Challenges of targeting vascular stability in acute kidney injury.

  2008cited by this paper
• Stem-cell approaches for kidney repair: choosing the right cells.

  2008cited by this paper
• Insulin-like growth factor-1 sustains stem cell mediated renal repair.

  2007cited by this paper
• Stromal cells protect against acute tubular injury via an endocrine effect.

  2007cited by this paper
• Incidence and outcomes in acute kidney injury: a comprehensive population-based study.

  2007cited by this paper
• The endothelial cell in ischemic acute kidney injury: implications for acute and chronic function.

  2007cited by this paper
• Vasculotropic, paracrine actions of infused mesenchymal stem cells are important to the recovery from acute kidney injury.

  2007cited by this paper
• Transplantation of Human Hematopoietic Stem Cells into Ischemic and Growing Kidneys Suggests a Role in Vasculogenesis but Not Tubulogenesis

  2006cited by this paper
• The multifaceted circulating endothelial cell in cancer: towards marker and target identification

  2006cited by this paper
• Bone marrow cell infusion ameliorates progressive glomerulosclerosis in an experimental rat model.

  2006cited by this paper
• Therapeutic potential of vasculogenesis and osteogenesis promoted by peripheral blood CD34-positive cells for functional bone healing.

  2006cited by this paper
• Chemokine receptor CX3CR1 regulates renal interstitial fibrosis after ischemia-reperfusion injury.

  2006cited by this paper
• Isolation and enumeration of circulating endothelial cells by immunomagnetic isolation: proposal of a definition and a consensus protocol

  2006cited by this paper
• Feasibility and safety of G-CSF administration to induce bone marrow-derived cells mobilization in patients with end stage liver disease.

  2006cited by this paper
• Restoration of tubular epithelial cells during repair of the postischemic kidney occurs independently of bone marrow-derived stem cells.

  2005cited by this paper
• Only a specific subset of human peripheral-blood monocytes has endothelial-like functional capacity.

  2005cited by this paper
• Circulating endothelial cells

  2005cited by this paper
• CD14+CD34low Cells With Stem Cell Phenotypic and Functional Features Are the Major Source of Circulating Endothelial Progenitors

  2005cited by this paper
• Circulating endothelial progenitor cells and cardiovascular outcomes.

  2005cited by this paper
• Chronic kidney disease: the global challenge

  2005cited by this paper
• Angiogenesis in life, disease and medicine

  2005cited by this paper
• Endothelial progenitor cells for postnatal vasculogenesis.

  2004cited by this paper
• Administration of CD34+ cells after stroke enhances neurogenesis via angiogenesis in a mouse model.

  2004cited by this paper
• Vascular repair by circulating endothelial progenitor cells: the missing link in atherosclerosis?

  2004cited by this paper
• Progenitor cell trafficking is regulated by hypoxic gradients through HIF-1 induction of SDF-1

  2004cited by this paper
• Chronic kidney disease as a risk factor for cardiovascular disease and all-cause mortality: a pooled analysis of community-based studies.

  2004cited by this paper
• Human hematopoietic colonies in health and disease.

  2004cited by this paper
• Are circulating CD133+ cells biomarkers of vascular disease?

  2004cited by this paper
• HGF, SDF-1, and MMP-9 are involved in stress-induced human CD34+ stem cell recruitment to the liver.

  2003cited by this paper
• Peritubular capillary loss after mouse acute nephrotoxicity correlates with down-regulation of vascular endothelial growth factor-A and hypoxia-inducible factor-1 alpha.

  2003cited by this paper
• Transdifferentiation of Human Peripheral Blood CD34+-Enriched Cell Population Into Cardiomyocytes, Endothelial Cells, and Smooth Muscle Cells In Vivo

  2003cited by this paper
• Therapeutic stem and progenitor cell transplantation for organ vascularization and regeneration

  2003cited by this paper
• Therapeutic Angiogenesis for Coronary Artery Disease

  2002cited by this paper
• Renal ischemic injury results in permanent damage to peritubular capillaries and influences long-term function.

  2001cited by this paper
• Impaired angiogenesis in the remnant kidney model: I. Potential role of vascular endothelial growth factor and thrombospondin-1.

  2001cited by this paper
• Salt-sensitive hypertension develops after short-term exposure to Angiotensin II.

  1999cited by this paper
• Tubulointerstitial disease in aging: evidence for underlying peritubular capillary damage, a potential role for renal ischemia.

  1998cited by this paper
• Receptor-mediated cellular entry of nuclear localizing anti-DNA antibodies via myosin 1.

  1997cited by this paper
• The biology of PECAM-1.

  1997cited by this paper
• The biology of PECAM-1.

  1997cited by this paper
• Acute renal failure.

  1996cited by this paper
• Harvesting, characterization, and culture of CD34+ cells from human bone marrow, peripheral blood, and cord blood.

  1994cited by this paper
• Acute Renal Failure

  1960cited by this paper

• Effect of injecting adipose stem cells combined with platelet-rich fibrin releasate at Shenshu acupoint (BL23) on acute kidney injury in rabbits

  2025cites this paper
• Bone Marrow Mononuclear Cells Administration Restore Lysophosphatidic Acid (LPA) Levels and Cellular Signaling Axis in Rats Submitted to Renal Ischemia–Reperfusion

  2025cites this paper
• Physical-Matched Nanoplatelets Boost Heterogeneous Thrombi Targeting Through Self-Adaptive Deformation for Thrombolysis and Endothelial Repairing.

  2024cites this paper
• High salt diet aggravates endothelial-to-mesenchymal transition in glomerular fibrosis in Dahl salt-sensitive rats.

  2023cites this paper
• Hepatoprotective Effects of Hyaluronic Acid-Preconditioned Bone Marrow Mesenchymal Stem Cells against Liver Toxicity via the Inhibition of Apoptosis and the Wnt/β-Catenin Signaling Pathway

  2023cites this paper
• Immunomagnetic Delivery of Adipose-Derived Endothelial Progenitor Cells for the Repair of Renal Ischemia–Reperfusion Injury in a Rat Model

  2023influential citation
• Prion Protein Overexpression in Adipose-Derived Mesenchymal Stem Cells (ADMSCs) Effectively Protected Rodent Kidney Against Ischemia-Reperfusion Injury Via Enhancing ATP/Mitochondrial Biogenesis—Role of ADMSC Rejuvenation and Proliferation

  2023influential citation
• Prevention of methylmercury-triggered ROS-mediated impairment of embryo development by co-culture with adult adipose-derived mesenchymal stem cells.

  2023cites this paper
• Repetitive administration of cultured human CD34+ cells improve adenine-induced kidney injury in mice

  2023cites this paper
• Comprehensive insight into endothelial progenitor cell-derived extracellular vesicles as a promising candidate for disease treatment

  2022cites this paper
• Rapamycin Improves Adipose-Derived Mesenchymal Stem Cells (ADMSCs) Renoprotective Effect against Cisplatin-Induced Acute Nephrotoxicity in Rats by Inhibiting the mTOR/AKT Signaling Pathway

  2022cites this paper
• Tissue Engineering Neovagina for Vaginoplasty in Mayer–Rokitansky–Küster–Hauser Syndrome and Gender Dysphoria Patients: A Systematic Review

  2022cites this paper
• Development of Cell Therapies for Renal Disease and Regenerative Medicine

  2022cites this paper
• Integrin α5 Is Regulated by miR-218-5p in Endothelial Progenitor Cells

  2022cites this paper
• Molecular Mechanisms of Kidney Injury and Repair

  2022cites this paper
• SIRT3 deficiency exacerbates early-stage fibrosis after ischaemia-reperfusion-induced AKI.

  2022cites this paper
• Hypoxia-Inducible Factor Protects Against Acute Kidney Injury via the Wnt/β-Catenin Signaling Pathway.

  2022cites this paper
• Modified chitosan for effective renal delivery of siRNA to treat acute kidney injury.

  2022cites this paper
• Comparison of Stromal Vascular Fraction and Adipose-Derived Stem Cells for Protection of Renal Function in a Rodent Model of Ischemic Acute Kidney Injury

  2022cites this paper
• Inhibition of histone methyltransferase G9a effectively protected the kidney against ischemia-reperfusion injury.

  2022cites this paper
• VEGF Receptor 1 Promotes Hypoxia-Induced Hematopoietic Progenitor Proliferation and Differentiation

  2022cites this paper
• Genipin-crosslinked decellularized scaffold induces regeneration of defective rat kidneys

  2022cites this paper
• Stem/progenitor cell in kidney: characteristics, homing, coordination, and maintenance

  2021cites this paper
• VEGF receptor promotes hypoxia-induced hematopoietic progenitor proliferation and differentiation

  2021cites this paper
• Overexpression of miR‐19a and miR‐20a in iPS‐MSCs preserves renal function of chronic kidney disease with acute ischaemia‐reperfusion injury in rat

  2021cites this paper
• Imaging Stem Cell-Based Myocardial Vasculoprotection

  2021cites this paper
• Lgr5-positive endothelial progenitor cells occupy a tumor and injury prone niche in the kidney vasa recta.

  2020cites this paper
• Peritubular Capillary Rarefaction: An Underappreciated Regulator of CKD Progression

  2020cites this paper
• All-trans retinoic acid has renoprotective effects on Cisplatin-induced acute kidney injury in rats.

  2020cites this paper
• Erythropoietin Preconditioning Mobilizes Endothelial Progenitor Cells to Attenuate Nephron-Sparing Surgery-Induced Ischemia-Reperfusion Injury.

  2020cites this paper
• Role of Mesenchymal Stem Cell in Identification of Hemotoxic Effect of sFas in cases of Nephrotoxicity

  2020cites this paper
• Novel repair mechanisms in a renal ischaemia/reperfusion model: Subsequent saxagliptin treatment modulates the pro-angiogenic GLP-1/cAMP/VEGF, ANP/eNOS/NO, SDF-1α/CXCR4, and Kim-1/STAT3/HIF-1α/VEGF/eNOS pathways.

  2019cites this paper
• Combined Therapy With Hyperbaric Oxygen and Melatonin Effectively Reduce Brain Infarct Volume and Preserve Neurological Function After Acute Ischemic Infarct in Rat.

  2019cites this paper
• Nephroprotective effect of losartan in IgA model rat

  2019cites this paper
• Flow Cytometric Analysis of Hematopoietic Populations in Rat Bone Marrow. Impact of Trauma and Hemorrhagic Shock

  2019cites this paper
• Urology and Nephrology: Regenerative Medicine Applications

  2019cites this paper
• Rat Mesenchymal Stromal Cell Sheets Suppress Renal Fibrosis via Microvascular Protection

  2019cites this paper
• Erythropoietin modulates macrophages but not post-ischemic acute kidney injury in mice.

  2019cites this paper
• Genetic communication by extracellular vesicles is an important mechanism underlying stem cell-based therapy-mediated protection against acute kidney injury

  2019cites this paper
• Preactivated and disaggregated shape‐changed platelets protect kidney against from ischemia‐reperfusion injury in rat through attenuating inflammation reaction

  2019cites this paper
• Loss of Renal Peritubular Capillaries in Hypertensive Patients Is Detectable by Urinary Endothelial Microparticle Levels

  2018cites this paper
• Human Peripheral Blood Mononuclear Cells Incubated in Vasculogenic Conditioning Medium Dramatically Improve Ischemia/Reperfusion Acute Kidney Injury in Mice

  2018cites this paper
• Harnessing CXCR4 antagonists in stem cell mobilization, HIV infection, ischemic diseases, and oncology

  2018cites this paper
• Ischemia-Reperfusion Injury Reduces Long Term Renal Graft Survival: Mechanism and Beyond

  2018cites this paper
• Endothelial colony‐forming cells and pro‐angiogenic cells: clarifying definitions and their potential role in mitigating acute kidney injury

  2018cites this paper
• The endothelial progenitor cell dysfunction in hypertension: the diagnostic and predictive values

  2018cites this paper
• Hypoxic Preconditioned Mesenchymal Stromal Cell Therapy in a Rat Model of Renal Ischemia-reperfusion Injury: Development of Optimal Protocol to Potentiate Therapeutic Efficacy

  2018cites this paper
• Induced pluripotent stem cell-derived endothelial progenitor cells attenuate ischemic acute kidney injury and cardiac dysfunction

  2018cites this paper
• Bone marrow–derived mesenchymal stem cells attenuate tubulointerstitial injury through multiple mechanisms in UUO model

  2018cites this paper
• Umbilical cord-derived mesenchymal stem cell transplantation in vaginal replacement in vitro and in a rat model.

  2018cites this paper
• Human vascular progenitor cells derived from renal arteries are endothelial-like and assist in the repair of injured renal capillary networks.

  2017cites this paper
• DPP-4 enzyme deficiency protects kidney from acute ischemia-reperfusion injury: role for remote intermittent bowel ischemia-reperfusion preconditioning

  2017cites this paper
• Multiple Mechanisms are Involved in Salt-Sensitive Hypertension-Induced Renal Injury and Interstitial Fibrosis

  2017cites this paper
• Chapter 81 – Renal Cells From Spermatogonial Germline Stem Cells for Protection Against Kidney Injury

  2017cites this paper
• Hyaluronic Acid Potentiates the Renoprotective Effects of Wharton Jelly –Derived Mesenchymal Stem Cells In a rat Model of Renal Ischemia Reperfusion Injury

  2017cites this paper
• Stem Cell Therapy and Tissue Engineering in Urogenital Diseases

  2017cites this paper
• Extendin-4 protects kidney from acute ischemia-reperfusion injury through upregulation of NRF2 signaling.

  2017cites this paper
• Hyperactive FOXO1 results in lack of tip stalk identity and deficient microvascular regeneration during kidney injury.

  2017cites this paper
• Stem Cell Mobilizers: Novel Therapeutics for Acute Kidney Injury.

  2017cites this paper
• Advances in the Knowledge about Kidney Decellularization and Repopulation

  2017cites this paper
• Recovery of renal function after administration of adipose-tissue-derived stromal vascular fraction in rat model of acute kidney injury induced by ischemia/reperfusion injury

  2017cites this paper
• Possible Protective Effect of Bone Marrow-Mesenchymal Stem Cells (BM-MSCs) Against the Remote Liver Injury Induced by Renal Ischemia Reperfusion in Male Albino Rats

  2017cites this paper
• Endothelial colony-forming cells ameliorate endothelial dysfunction via secreted factors following ischemia-reperfusion injury.

  2017cites this paper
• Protective Effects of Ischemic Preconditioning-Mediated Homing of Endothelial Progenitor Cells on Renal Acute Ischemia and Reperfusion Injury in Male Rats

  2017cites this paper
• Novel regenerative therapy for acute kidney injury

  2016cites this paper
• Unfractionated bone marrow cells attenuate paraquat-induced glomerular injury and acute renal failure by modulating the inflammatory response

  2016cites this paper
• Wnt4 is a novel biomarker for the early detection of kidney tubular injury after ischemia/reperfusion injury

  2016cites this paper
• Global miRNA expression is temporally correlated with acute kidney injury in mice

  2016cites this paper
• Hematopoietic stem cells: Can it be a therapeutic option for the hematopoietic failure in patients with trauma-hemorrhagic shock?

  2016cites this paper
• Enhanced protection against renal ischemia–reperfusion injury with combined melatonin and exendin-4 in a rodent model

  2016cites this paper
• Preischemic Administration of Nonexpanded Adipose Stromal Vascular Fraction Attenuates Acute Renal Ischemia/Reperfusion Injury and Fibrosis

  2016cites this paper
• Modulation of renal ischemia/reperfusion in rats by a combination of ischemic preconditioning and adipose-derived mesenchymal stem cells (ADMSCs).

  2016cites this paper
• CD146(+) cells are essential for kidney vasculature development.

  2016cites this paper
• Losartan reduces ensuing chronic kidney disease and mortality after acute kidney injury

  2016cites this paper
• Overexpression of Heme Oxygenase-1 Prevents Renal Interstitial Inflammation and Fibrosis Induced by Unilateral Ureter Obstruction

  2016cites this paper
• Blocking protein phosphatase 2A signaling prevents endothelial-to-mesenchymal transition and renal fibrosis: a peptide-based drug therapy

  2016cites this paper
• Protective effect of lyophilized recombinant human brain natriuretic peptide on renal ischemia/reperfusion injury in mice.

  2015influential citation
• CXC-chemokine receptor 4 antagonist prevents acute kidney injury potentially through recruiting bone marrow-derived stem cells

  2015cites this paper
• Diverse Cell Populations Involved in Regeneration of Renal Tubular Epithelium following Acute Kidney Injury

  2015cites this paper
• The real face of endothelial progenitor cells — Circulating angiogenic cells as endothelial prognostic marker?

  2015cites this paper
• Endothelial Progenitor Cells Derived from Wharton's Jelly of Human Umbilical Cord Attenuate Ischemic Acute Kidney Injury by Increasing Vascularization and Decreasing Apoptosis, Inflammation, and Fibrosis

  2015cites this paper
• Growth factor and small molecule influence on urological tissue regeneration utilizing cell seeded scaffolds.

  2015cites this paper
• Acute kidney injury: preclinical innovations, challenges, and opportunities for translation

  2015cites this paper
• The administration of erythropoietin attenuates kidney injury induced by ischemia/reperfusion with increased activation of Wnt/β-catenin signaling.

  2015cites this paper
• Human endothelial colony-forming cells protect against acute kidney injury: role of exosomes.

  2015cites this paper
• Angiopoietin-Like-4, a Potential Target of Tacrolimus, Predicts Earlier Podocyte Injury in Minimal Change Disease

  2015cites this paper
• Upregulation of podocyte-secreted angiopoietin-like-4 in diabetic nephropathy

  2015cites this paper
• CATACGCCATCACC GGTTGTAGTAGCCTTG CTTCTTGTGCAGTG TGCAGCGAACTTTATT ATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTCAACA GGTAGCTTATCAGACTG TGCAGGGTCCGAGG ATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACGGCTGT GGCTGACCTATGAATTG TGCAGGGTCCGAGG ATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCTGTTC GGTGGCTCAGTTCAGCAG TGCAGGGTCCGAG

  2015cites this paper
• Resident Endothelial Cells and Endothelial Progenitor Cells Restore Endothelial Barrier Function After Inflammatory Lung Injury

  2015cites this paper
• Postconditioning attenuates renal ischemia–reperfusion injury by mobilization of stem cells

  2015cites this paper
• The recruitment mechanisms and beneficial roles of haematopoietic stem cells in murine acute kidney injury

  2014influential citation
• CXCR₄antagonism as a therapeutic approach to prevent acute kidney injury.

  2014cites this paper
• An Obligatory Role of NF-κB in Mediating Bone Marrow Derived Endothelial Progenitor Cell Recruitment and Proliferation Following Endotoxemic Multiple Organ Injury in Mice

  2014cites this paper
• Membrane-Derived Extracellular Vesicles from Endothelial Progenitor Cells Activate Angiogenesis

  2014cites this paper
• The Calcineurin Inhibitor Tacrolimus Reduces Proteinuria in Membranous Nephropathy Accompanied by a Decrease in Angiopoietin-Like-4

  2014cites this paper
• Peritubular capillary rarefaction: a new therapeutic target in chronic kidney disease

  2014cites this paper
• Regenerative Medicine for the Kidney: Renotropic Factors, Renal Stem/Progenitor Cells, and Stem Cell Therapy

  2014cites this paper
• Hematopoietic stem cells derived from human umbilical cord ameliorate cisplatin-induced acute renal failure in rats.

  2014cites this paper
• Multiple Mechanisms in Renal Artery Stenosis-Induced Renal Interstitial Fibrosis

  2014cites this paper
• Additional benefit of combined therapy with melatonin and apoptotic adipose‐derived mesenchymal stem cell against sepsis‐induced kidney injury

  2014cites this paper